ID: 1142398345

View in Genome Browser
Species Human (GRCh38)
Location 16:89845754-89845776
Sequence GGTGAGGTTCCAGTTTTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 112}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142398345_1142398357 27 Left 1142398345 16:89845754-89845776 CCGACCAAAACTGGAACCTCACC 0: 1
1: 0
2: 0
3: 10
4: 112
Right 1142398357 16:89845804-89845826 ACCTGCCCTGAAGTCATGTCTGG 0: 1
1: 0
2: 1
3: 15
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142398345 Original CRISPR GGTGAGGTTCCAGTTTTGGT CGG (reversed) Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
902660901 1:17902883-17902905 GTTGAGGTTTCTGTTTTTGTGGG - Intergenic
902863236 1:19260620-19260642 GGTCAGGTGCCAGGCTTGGTCGG + Intergenic
904310207 1:29624462-29624484 AATGAGGTTTCAGGTTTGGTTGG + Intergenic
906276054 1:44516944-44516966 GGAGAGGGAACAGTTTTGGTGGG - Intronic
906464340 1:46062798-46062820 GTTTCGGTTTCAGTTTTGGTTGG + Intronic
907075062 1:51570819-51570841 GGTGAGGTTCCTTTTTTTTTTGG + Intergenic
910441217 1:87253914-87253936 GGTGAGGTTACACTGTTGGTGGG - Intergenic
916341858 1:163745443-163745465 GGGGAGGATACAGTTTTGGCAGG - Intergenic
918198937 1:182248863-182248885 GGGGAGTTTCCAGTTTTGTGGGG - Intergenic
918277506 1:182967719-182967741 AGTGAGTTTCCCATTTTGGTGGG + Intergenic
919604309 1:199662310-199662332 GCAGAGGTACCAGTTTTGTTTGG + Intergenic
920146979 1:203870247-203870269 GGTAAGCTTCCAGTATTGGGAGG + Exonic
922240542 1:223752876-223752898 GGTGAGTTTCCACTTCTTGTAGG - Exonic
1063876911 10:10489218-10489240 AGTGAGGTTTCATTTTTGTTAGG - Intergenic
1069627171 10:69875502-69875524 GGTGAGCTGCCAGCTTTGGGGGG - Intronic
1072451745 10:95544346-95544368 TGTGAGGGTCCAGTCTTGGGAGG - Intronic
1073458074 10:103649819-103649841 GGTGAGGTTGCTGTTGAGGTTGG - Intronic
1073845075 10:107545137-107545159 GCTGAGCTTCCAGTTCTGGGTGG + Intergenic
1073871540 10:107870612-107870634 GGTAAGTTTCCAGTGTTGGGGGG - Intergenic
1077139481 11:1017627-1017649 GGTGGGGTTCCTGTACTGGTGGG + Exonic
1085553519 11:77397944-77397966 GATGAGGTTTGAGTTTTGCTGGG - Intronic
1090208493 11:124898876-124898898 GCTGAGATTCCAGATTTGGAAGG - Intergenic
1090436040 11:126687046-126687068 GGTGAGGTTGCAAGTGTGGTTGG + Intronic
1090808363 11:130216956-130216978 CGTGAGGTTCCAGTTCTGAAAGG - Intergenic
1092459878 12:8676927-8676949 GGTGACATTCCAATTTTGGAAGG - Intergenic
1092931072 12:13316382-13316404 GGTTGGATTCCAGTTTTGGGAGG + Intergenic
1094509159 12:31085697-31085719 GGTGAGGTTCCAGTGTGAATGGG - Intronic
1097334133 12:58363347-58363369 GGTGAGAAAGCAGTTTTGGTAGG + Intergenic
1103688921 12:122754285-122754307 GGTGAGGTTGGAGTGTTGGGTGG + Intronic
1108586811 13:51877032-51877054 GGTGAGTGTCAAGTTTTGGCTGG - Intergenic
1109895283 13:68678972-68678994 CTTGAGGTTGCAATTTTGGTTGG + Intergenic
1111419779 13:87997761-87997783 GGTGGGGGTGCAGTTTTTGTGGG + Intergenic
1118064958 14:62180553-62180575 GATGAGGATCTAGTTTTGGCAGG + Intergenic
1118313174 14:64707621-64707643 GGTGAGGTGACAGTTTAGATAGG + Intronic
1120743875 14:88136558-88136580 TCTGAGGTTCCAGTGGTGGTTGG - Intergenic
1122760207 14:104019198-104019220 GGTGAGCTTCCAGTTCTGCATGG + Intronic
1123021553 14:105400089-105400111 CGTGTGGTTCCACTTTTGGAAGG + Intronic
1127656039 15:61057044-61057066 GGTGATGTGACATTTTTGGTAGG + Intronic
1128197473 15:65772899-65772921 GGTGAGGGTCCACTTTTGGGTGG - Intronic
1128453331 15:67819755-67819777 GGAGAGGGTCCGGATTTGGTGGG - Intronic
1130774245 15:86961525-86961547 GGAGAGGGTCCAGTGGTGGTGGG + Intronic
1131011603 15:89022556-89022578 GCTCAGGTTCCAGTGATGGTGGG + Intergenic
1131446023 15:92498836-92498858 GGTTAGGTTAGAGTTTTGGTGGG - Intronic
1140159128 16:72467182-72467204 TGTGATGTTCCAGTTTTTTTGGG + Intergenic
1140323260 16:73974547-73974569 TGTGTGGTTCCTGTCTTGGTAGG + Intergenic
1142398345 16:89845754-89845776 GGTGAGGTTCCAGTTTTGGTCGG - Intronic
1142779942 17:2173804-2173826 GGTCAGATTCCTGCTTTGGTGGG + Intronic
1148235145 17:45963823-45963845 GGAGAGGTTCCAGGACTGGTTGG + Intronic
1151519818 17:74619903-74619925 GGTGACCTTCCAGATTTGCTAGG - Intronic
1151848802 17:76677335-76677357 GGTGAGGTTCCAGCTGTTATTGG - Exonic
1152257717 17:79249757-79249779 AGGGAGGTACCAGGTTTGGTCGG - Intronic
1156521135 18:37723202-37723224 GGTGAGATTTCAGTATTTGTGGG - Intergenic
1159436686 18:68426934-68426956 GATGTGGTTTCAGTTTTTGTTGG + Intergenic
1160576235 18:79855546-79855568 GGTGAGGCTGGAATTTTGGTGGG - Intergenic
1161566633 19:5006214-5006236 GGTGGGGTTCCAGTAGTGGCGGG - Intronic
1161996369 19:7714803-7714825 GGTAAAGTTTCAGTTTTTGTTGG - Intergenic
1164389996 19:27810799-27810821 GTGGTGGTTCCAGTTTTGTTTGG + Intergenic
1165068692 19:33242959-33242981 GGTGAGGTGGCAGCTTTGGTGGG + Intergenic
926647980 2:15310705-15310727 GGTGAGGGCCCAGGTTTCGTGGG - Intronic
927040408 2:19224543-19224565 GGTGCTGATGCAGTTTTGGTAGG - Intergenic
927356467 2:22179030-22179052 GATGAGCTTCAAGTTTTGGTGGG + Intergenic
929192700 2:39154308-39154330 GATGAGGTTCCAGCTATGGCAGG - Intergenic
930550104 2:52823039-52823061 GGTGAGCTCACAGTTTTTGTGGG - Intergenic
931864982 2:66399709-66399731 GGAGAGGGTCCAGTGGTGGTGGG - Intergenic
943116309 2:183676063-183676085 GCTGAGGATCCAATATTGGTAGG + Intergenic
1168912270 20:1458359-1458381 ACTGAGGTTACATTTTTGGTAGG + Intronic
1169405464 20:5317756-5317778 GGTCAGGTTCCAGGTAAGGTGGG - Intergenic
1169763351 20:9120989-9121011 GGTGAGGTTCCAGTGTGAGGAGG - Intronic
1175701954 20:61145787-61145809 GCTGAGGTTACAGCTGTGGTGGG - Intergenic
1176139570 20:63539071-63539093 GCTGAGCTTCCAGTTCTGGCAGG - Intergenic
1177516680 21:22160591-22160613 AGTGATGTTCCATTTTTGTTGGG - Intergenic
1178814408 21:35914593-35914615 GGTAAGGTTCTAGTTTTGTTTGG + Intronic
1180124331 21:45778804-45778826 GGGCAGGTACCAGCTTTGGTTGG + Intronic
1182728045 22:32464300-32464322 GGAGATGTCCCAGATTTGGTAGG - Intronic
949900652 3:8812328-8812350 GATGAGGCTCAAGATTTGGTAGG + Intronic
951160656 3:19416944-19416966 GGTGTAGTTCCAGTGTTTGTAGG + Intronic
954215681 3:49123110-49123132 GGTGAGGTTGAAGTGTTGGGTGG - Exonic
955205941 3:56895882-56895904 GAAGAGTTTCCAGTTTTGTTTGG + Intronic
958491780 3:94783692-94783714 TGTGTTGTTCCAGTTTAGGTTGG - Intergenic
958950506 3:100410920-100410942 TGTGCCCTTCCAGTTTTGGTGGG + Intronic
961423815 3:126829357-126829379 GGTGAGTTTCCTGTTTTTATGGG - Intronic
965780749 3:172283345-172283367 GGGGGCGTTCCAGTTTTTGTGGG + Intronic
967596881 3:191336073-191336095 TATGAGTTTTCAGTTTTGGTGGG + Intronic
975084284 4:70318745-70318767 GGTGATTTCCCAGTTTTGGTTGG - Intergenic
976347915 4:84026386-84026408 GGTGGGGGTCCAGATCTGGTTGG - Intergenic
976903696 4:90209454-90209476 GGTGTGGTCCCAGTCTTGCTTGG + Intronic
976966466 4:91047683-91047705 GGTGAGATTTCAGTTTTTGATGG + Intronic
977374603 4:96185487-96185509 GGCAAGGTTCATGTTTTGGTGGG + Intergenic
981018328 4:139999178-139999200 CCTGAGGTTGCAGTTGTGGTTGG - Intronic
981975538 4:150723484-150723506 GGTAAGGATCCAGTCCTGGTAGG + Intronic
983670688 4:170233872-170233894 GGTGAGCTTCAAGTGTTTGTGGG - Intergenic
987078066 5:14402900-14402922 GGTGAGGGTACAGATTTTGTTGG + Intronic
987217276 5:15749926-15749948 GGTAAGGGACAAGTTTTGGTGGG + Intronic
988305926 5:29494351-29494373 AGTGAGGTGCAAGTTTGGGTTGG - Intergenic
990062240 5:51666293-51666315 AGTGAGATTCCAGTTTTTGAAGG - Intergenic
996767262 5:127046930-127046952 GGTGATGTTTCAGTTTTGGGTGG + Exonic
996776056 5:127134138-127134160 GGGGAGGATCCAGATTTTGTGGG - Intergenic
1000893711 5:166829364-166829386 GGTGATGGTCCAAATTTGGTTGG - Intergenic
1002704878 5:181153941-181153963 AGTGAGGTTTCAGTTATGCTGGG - Intergenic
1003477483 6:6497649-6497671 GGTGACTTTCCAGTTCTTGTGGG + Intergenic
1005182866 6:23126254-23126276 GGTGAGGTTCTCTTCTTGGTTGG + Intergenic
1025189629 7:56886842-56886864 GGTGAGGTTACAGTTTCATTAGG - Intergenic
1025251972 7:57357483-57357505 GGTGAAGTTCCCGCTTTCGTAGG + Intergenic
1025682309 7:63690075-63690097 GGTGAGGTTACAGTTTCATTAGG + Intergenic
1027378071 7:77574231-77574253 GGTAAGTTTACAGTTTTGGCTGG + Intronic
1027659105 7:80967617-80967639 GGTTTGCTTCCAGTTTAGGTTGG + Intergenic
1029212546 7:98920786-98920808 AGTGAGGTTCCAGTCCTGGGTGG - Intronic
1029303273 7:99600820-99600842 GGTGATGTTCCAGGTGTGGAGGG + Intronic
1030605267 7:111633224-111633246 GGTGTGGTTCCAGTCTGGGTGGG + Intergenic
1030811912 7:113982999-113983021 ATTGAGGTTCCAGTATAGGTTGG + Intronic
1035032425 7:155870126-155870148 GGAGATGTTCCAGTTTGGGAAGG - Intergenic
1041144631 8:54860916-54860938 GGTGAGGGCCAAGTTTTGGCTGG + Intergenic
1044707121 8:95019533-95019555 GCTGATGGTCCATTTTTGGTAGG + Intronic
1046758010 8:117991430-117991452 GGAGAGGGTCCAGTGGTGGTAGG - Intronic
1050521168 9:6501869-6501891 GGTGAGTTTCCACTGTAGGTGGG + Intronic
1054822216 9:69534256-69534278 GGTGAGCTTCAATTTTTGGTGGG - Intronic
1056060700 9:82882955-82882977 GTTCAGGTTAAAGTTTTGGTGGG - Intergenic
1061482761 9:130905212-130905234 GGTGAGGCTCCAGCTGTGGCAGG - Exonic
1187325058 X:18278770-18278792 GGTCAGGTTCCAGCTGTGCTGGG - Intronic
1188323472 X:28770225-28770247 GGGGAGGATCTAGTTTTGATGGG + Intronic
1197662756 X:129191847-129191869 GCTCAGCTTCCAGTCTTGGTTGG - Intergenic
1200475563 Y:3636977-3636999 GTTGAAGTTCCAGTTTAGCTAGG - Intergenic