ID: 1142403906

View in Genome Browser
Species Human (GRCh38)
Location 16:89875422-89875444
Sequence TTCTGCGTGCTGAAAGATAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 106}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142403906 Original CRISPR TTCTGCGTGCTGAAAGATAC TGG Intronic
900462150 1:2806710-2806732 TTCTGCGTGATTAATGATTCTGG - Intergenic
900916316 1:5641265-5641287 TTGTGCGTGCTCACAGAGACAGG - Intergenic
902724921 1:18328997-18329019 TTCTCCCTGCTGGAAGAAACAGG - Intronic
909729766 1:78876752-78876774 TTCTGCTTGCTGAGAGGTAGTGG - Intergenic
910458872 1:87426845-87426867 TACTCTGTGCTGAAAGACACAGG - Intergenic
911322198 1:96428382-96428404 TACAGCTTGCTGATAGATACTGG + Intergenic
912082737 1:105957725-105957747 TTGTACGTGGTGAAAGATAGAGG + Intergenic
919995756 1:202748426-202748448 TCCTGCTTGCTGAAAGACACTGG + Intronic
922029528 1:221784391-221784413 TACTGCGTGCTGGAGGACACGGG - Intergenic
924570676 1:245234959-245234981 CTCTGCCTTCTGAAAGACACAGG - Intronic
924649538 1:245912824-245912846 TTCTGTGTGGTGACAGATAAGGG - Intronic
1066436868 10:35403758-35403780 TTCGGCTTGCTGAGAGATAGTGG + Intronic
1069625418 10:69864946-69864968 TTCTCCCTGCTGCAAGAAACAGG + Intronic
1069738953 10:70675248-70675270 TTCTGAGTGCAGAGAGACACTGG + Intronic
1073047500 10:100648823-100648845 TTCTGCCTCCTGAAACATGCTGG - Intergenic
1076575807 10:131466368-131466390 TTCTGCTTGATGAAAGAAAATGG - Intergenic
1079746265 11:24134864-24134886 TTCTCCGAGCTCACAGATACAGG + Intergenic
1080424705 11:32145067-32145089 TTCTGCGGGCTAAAAGTTGCAGG + Intergenic
1080593753 11:33749040-33749062 TTCTAAGTTCTCAAAGATACTGG + Intronic
1081690840 11:45076933-45076955 TTCTGCCTAAGGAAAGATACAGG + Intergenic
1085988313 11:81810500-81810522 TTCAGCTTGCTGAGAGATAGTGG - Intergenic
1086161766 11:83729619-83729641 CTCTGTGAGCTGAAAAATACAGG + Intronic
1088830153 11:113530014-113530036 TTCTGCATTCTACAAGATACAGG - Intergenic
1092950594 12:13499541-13499563 TTCTGTGAGGTGAAAGATGCTGG + Intergenic
1093543130 12:20311436-20311458 TTCTGCTTGTAGAAAGATAATGG + Intergenic
1097541881 12:60953399-60953421 TTCGGCTTGCTGAGAGATAGTGG + Intergenic
1097846144 12:64368900-64368922 TTCTGCTTTGTGAAAGATACTGG + Intronic
1105663359 13:22524430-22524452 TTGTGTGTGGTGAGAGATACTGG - Intergenic
1106443471 13:29801491-29801513 CTCTGCTTGCTGAAAAATGCGGG - Intronic
1107323044 13:39209783-39209805 TTCTGCCTCCTGAAAGTTAGGGG + Intergenic
1111185972 13:84736515-84736537 TTTTGAGTGCTAAAAGATGCTGG - Intergenic
1111426924 13:88097108-88097130 TTCTTCCTGCTGAAAGAAAGGGG - Intergenic
1112889057 13:104209732-104209754 TTCGGCTTGCTGAGAGATAGTGG + Intergenic
1122613290 14:103000388-103000410 TTCTGAGTGCTGCAAGAGACAGG - Intronic
1124230130 15:27937546-27937568 TACTGAGTGCTGAAAGATTGTGG - Intronic
1128425280 15:67536732-67536754 TACTGGGTGCTGAAGGAGACAGG + Intergenic
1128648853 15:69396152-69396174 TACTCCATGCTGAGAGATACAGG + Intronic
1133139464 16:3733583-3733605 AACTGCGTGCTGCAATATACTGG + Intronic
1142403906 16:89875422-89875444 TTCTGCGTGCTGAAAGATACTGG + Intronic
1143579896 17:7819245-7819267 TTCTTCGTGCTCAATGATATGGG + Exonic
1149990673 17:61381740-61381762 ATCTGCGTGCTGAAGAATGCTGG - Intronic
1154237899 18:12623549-12623571 TTATGTGTGCTGAAAAATACTGG + Intronic
1164786864 19:30939199-30939221 TTCTATTTGCTGAAAGATAAGGG + Intergenic
1167752239 19:51388056-51388078 TTCTGCCTGCTGGAAGCTGCTGG - Intergenic
925805363 2:7643294-7643316 TTCTGAATGCAGAAAGAAACAGG - Intergenic
926760542 2:16275095-16275117 TTATGAGCGCTGAAAGAAACAGG + Intergenic
928476853 2:31635730-31635752 TTGTGTATGCTGAAAGATAGAGG + Intergenic
929684211 2:44020461-44020483 TTCGGCTTGCTGAGAGATAGTGG + Intergenic
930942095 2:57025622-57025644 TTCTGCGGTCTGAAGGATGCTGG + Intergenic
933105058 2:78314080-78314102 TTCTGTGTGGTGTAAGATAGAGG - Intergenic
933833439 2:86228126-86228148 TCCTGGGTGCTGAAAGCAACAGG + Intronic
935733735 2:106089462-106089484 TTCTGAGTGCTGTAAGACTCTGG + Intergenic
935939629 2:108224552-108224574 TTCTGGGTTCTGAAAGGTTCAGG - Intergenic
936431583 2:112469042-112469064 TTCTGTATGGTGAAAGATAGGGG - Intergenic
940183247 2:150957134-150957156 TTCAGCTTGCTGAGAGATAGTGG - Intergenic
940508550 2:154585160-154585182 TTCGGCTTGCTGAAAGGTAGTGG + Intergenic
941323163 2:164080937-164080959 CTCTCCCTGCTGACAGATACAGG + Intergenic
942033859 2:171991485-171991507 TACTGCATGTTGAAAGATAATGG + Intronic
944074838 2:195717504-195717526 TTCTGGGTGCTAAAAGAGTCTGG - Intronic
944478365 2:200129484-200129506 CTCTGCTTGCTGTAGGATACAGG + Intergenic
945150000 2:206780867-206780889 TTTTGCTTGCTGAAATATGCTGG + Intronic
1169879448 20:10330586-10330608 TACTGCGTGTTGAAAGATACGGG + Intergenic
1175428119 20:58883214-58883236 GTCTGCCTTCTGAAAGAAACTGG + Intronic
1182355105 22:29719415-29719437 TTCTGCAAGCTGAAAGGTAGGGG + Intergenic
949834284 3:8251134-8251156 TTCTCTGTGCTGATAGAGACAGG - Intergenic
951177112 3:19615103-19615125 TTCTGGGGTCTGAAAGATAGTGG + Intergenic
957000884 3:74883333-74883355 TTCTGCATGCAGAATGAGACTGG + Intergenic
957162599 3:76629492-76629514 TCCTGCATGCAGAAAGATGCAGG + Intronic
957252400 3:77790299-77790321 TTCTGCCTGCTGAGAGAAACTGG + Intergenic
957505990 3:81121856-81121878 TTATTAGTGATGAAAGATACAGG + Intergenic
957832909 3:85546408-85546430 TTCCCCTTGCTGAAAGACACAGG + Intronic
965144683 3:164886325-164886347 TTGTACGTGCTGAAAGATAGGGG + Intergenic
966398151 3:179522563-179522585 TTCGGCTTGCTGAGAGATAGTGG + Intergenic
969618619 4:8267928-8267950 TTCTGCGCACTGAAGGATCCAGG + Intergenic
973650890 4:52996187-52996209 TCCTACATGCTGAAAGAGACAGG + Intronic
987545874 5:19309710-19309732 TTCTGGGTGCTGAAGGATGATGG + Intergenic
989216777 5:38912894-38912916 TTCTACATGGTGAAAGGTACAGG - Intronic
990062211 5:51665659-51665681 TTCTGCTTACTGATACATACAGG - Intergenic
995322209 5:110848403-110848425 TTGTGCATGCTGAGAGATAGGGG + Intergenic
995632662 5:114150683-114150705 TTCTGAGTCCTGTAAGATACAGG - Intergenic
996483429 5:124001729-124001751 TGCTGGGTGCTGATAGATATTGG - Intergenic
998555310 5:143117490-143117512 TTCAGTGTGCCGAAAGATAATGG + Intronic
998761033 5:145432788-145432810 TTCTGCCTGCTGAGATAAACAGG + Intergenic
1002017210 5:176334478-176334500 CTCAGAGTGCTGAAAGATACTGG - Intronic
1002695875 5:181088170-181088192 TTCATCATGCTGAAAAATACTGG + Intergenic
1004087414 6:12464276-12464298 TTCTACGTTCTGAAAGAACCTGG - Intergenic
1006981000 6:38148130-38148152 TTGTGTGTGGTGAAAGATAGGGG + Intronic
1010882412 6:81194774-81194796 TTCTGCACTGTGAAAGATACTGG - Intergenic
1017056381 6:150439969-150439991 TTGTGCCTGCTGACAGATGCAGG - Intergenic
1017922543 6:158884819-158884841 TTCGGCTTGCTGAGAGATAGTGG + Intronic
1018077872 6:160232399-160232421 TTCAGCTTGCTGAGAGATAGTGG - Intronic
1019649135 7:2147166-2147188 CTCTGTGAGCTGAAAGGTACTGG - Intronic
1021972379 7:25978188-25978210 TTCTTGGTGCTGAGAGACACAGG - Intergenic
1023265054 7:38395880-38395902 TTCTGCTGGCTCAAAGGTACAGG + Intronic
1024808279 7:53175625-53175647 TTGTGCGTGGTGCAAGATAAAGG - Intergenic
1029894031 7:103962535-103962557 TTCTGTGAGCTGAAATCTACTGG - Intronic
1029993238 7:104981668-104981690 TTCTGCCTGCTGAATGACAAAGG + Intergenic
1036006780 8:4673884-4673906 TAATGATTGCTGAAAGATACAGG + Intronic
1036171079 8:6485429-6485451 TTCTGTGTGCTGAAGTTTACAGG + Intronic
1036733460 8:11285631-11285653 TTCTGCTTGCTGAAAGAACAGGG + Intronic
1037120930 8:15286268-15286290 ATCTGGGAGCTGAAAGTTACAGG + Intergenic
1038480816 8:27900874-27900896 TTCTGCTTGCTGAGAGATAAAGG - Intronic
1044051195 8:87507101-87507123 TTTTGCCTGCTAAAAGATAAAGG + Intronic
1044078428 8:87853898-87853920 ATCTGCTTTCTGAAAGACACTGG + Intergenic
1048961120 8:139578774-139578796 TTCAAAGTGCTGAAAGATAAAGG - Intergenic
1052163381 9:25291973-25291995 TTCGGCTTGCTGAGAGGTACTGG - Intergenic
1055864531 9:80797145-80797167 CTCTGTGTGCTGAAAGAAAAGGG + Intergenic
1056289789 9:85131504-85131526 TGCTGCGTGTAGAAAGAGACAGG - Intergenic
1059728911 9:117036772-117036794 CTCTGCCTGCTGATAGATACGGG + Intronic
1187394725 X:18909432-18909454 TGCTGCCTGCAGAAAGAGACAGG - Intronic
1188042276 X:25382810-25382832 TTCAGCTCGCTGAAAGGTACTGG + Intergenic
1189737196 X:44083610-44083632 TTCTGTGTTTTGAAAAATACAGG + Intergenic
1194168927 X:90557537-90557559 TTATGGAAGCTGAAAGATACTGG - Intergenic
1196326838 X:114415387-114415409 TTCTGGGTGATGGAAGATTCTGG - Intergenic
1197444768 X:126538414-126538436 TTCAGGAAGCTGAAAGATACAGG + Intergenic
1198436385 X:136620773-136620795 TTCTAGGCACTGAAAGATACAGG - Intergenic
1198628843 X:138612024-138612046 TTCTAGGAGCTGAAAAATACAGG + Intergenic
1199001574 X:142644269-142644291 GTATGTGTGCTGAAATATACAGG + Intergenic