ID: 1142407015

View in Genome Browser
Species Human (GRCh38)
Location 16:89895935-89895957
Sequence ATGGCCACACACAGCAACCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 270
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142407015_1142407016 -8 Left 1142407015 16:89895935-89895957 CCGTGGTTGCTGTGTGTGGCCAT 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1142407016 16:89895950-89895972 GTGGCCATGACACCCTCCCCTGG 0: 1
1: 0
2: 3
3: 25
4: 229
1142407015_1142407027 30 Left 1142407015 16:89895935-89895957 CCGTGGTTGCTGTGTGTGGCCAT 0: 1
1: 0
2: 1
3: 26
4: 242
Right 1142407027 16:89895988-89896010 AGAGAGAGCGCTGTACAGCATGG 0: 1
1: 0
2: 0
3: 6
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142407015 Original CRISPR ATGGCCACACACAGCAACCA CGG (reversed) Intronic
901343772 1:8519915-8519937 TTAGCCACAGACAGCAAGCAAGG + Intronic
902329888 1:15726093-15726115 ATGGCCCCAGACACCAGCCACGG - Intronic
902388397 1:16088861-16088883 ATGGGCACACACAGCACTGAGGG + Intergenic
902621628 1:17654221-17654243 AGGGCCACGCACAGAAACCAGGG - Intronic
902656595 1:17873338-17873360 ATGGCCACACCCAATATCCATGG + Intergenic
902769254 1:18636332-18636354 AAGGCCAAACACAGCATCGACGG + Exonic
904360153 1:29965933-29965955 ATGGCCCCACCCAGCTGCCAAGG + Intergenic
904641809 1:31937412-31937434 ATCGCCACACACAAAGACCAAGG + Intronic
904984088 1:34530256-34530278 ATGGCCCCAAACAGCAAGGAAGG - Intergenic
905110246 1:35589611-35589633 AGGGCCACACACACCTACCAGGG - Intronic
905281199 1:36850429-36850451 ATGGACACAGACAGAAAACAGGG + Intronic
905508996 1:38503498-38503520 CTGGCCACACACAACAGCCAGGG + Intergenic
906541874 1:46592984-46593006 AGGGTGACACACAGCCACCAGGG + Intronic
907642527 1:56205818-56205840 ATGGCCACATAGAGAAAGCAAGG + Intergenic
908007303 1:59740018-59740040 AGGGCCACACACAGGAACTGTGG - Intronic
911164542 1:94713078-94713100 ATGCCCACAGCCAGCCACCAAGG - Intergenic
914799666 1:150951270-150951292 ATGGCCACACTGAGCAACCTTGG + Intronic
914825214 1:151134547-151134569 ATGGCCACAGACACCATCCCAGG - Intronic
915317375 1:155036748-155036770 AGGTCCACACACAGCCTCCAAGG - Intronic
915493154 1:156262909-156262931 ATGGCCCCACCCAGCCTCCATGG + Intronic
915651235 1:157312393-157312415 ATGGGCACAAACCCCAACCATGG + Intergenic
918962361 1:191297255-191297277 ATGCCCACACACATCATCTAGGG - Intergenic
919794264 1:201311730-201311752 AGGGCCAAACCCAGCAACCTAGG - Intronic
920112749 1:203598654-203598676 CTGGCCCCACACAGCCAGCAGGG - Intergenic
920777389 1:208953157-208953179 ATGGCCAGACACCCCAAGCAGGG + Intergenic
921160128 1:212466669-212466691 ATGGCCAGACCCACCAACCTGGG + Intergenic
923307270 1:232699594-232699616 ATGGCCACACCCAGCCTCAAGGG + Intergenic
924102290 1:240617296-240617318 ATGGATACACACAGAAACAAAGG - Intergenic
924145043 1:241065030-241065052 GTGGCCTCACAGAGAAACCATGG + Intronic
1062798728 10:363534-363556 GAGGCCACACACAGCACCCGCGG + Intronic
1064296913 10:14087096-14087118 ATGCCCACCCCCCGCAACCAGGG - Intronic
1064782667 10:18859509-18859531 ACGACCACAAACAGCAACAAGGG + Intergenic
1065186935 10:23177634-23177656 ATAGCCACACAGAGCTGCCATGG + Intergenic
1065605793 10:27416229-27416251 AAGGCCACACAAAGGAACAAAGG - Intergenic
1065841160 10:29702440-29702462 ATGGACCCACAGAGCAGCCACGG + Intronic
1070359765 10:75676175-75676197 AAGGCCACACCCAGGAGCCAGGG - Intronic
1070843645 10:79505169-79505191 AGGGCCACACAGAGCTGCCATGG - Intergenic
1070930021 10:80254431-80254453 AGGGCCACACAGAGCTGCCATGG + Intergenic
1071867846 10:89756095-89756117 AAGGACACACACTTCAACCAAGG - Intronic
1076492883 10:130875517-130875539 AGGGCCACACACACAAACCTGGG + Intergenic
1076834518 10:133014398-133014420 GAGGCCACATCCAGCAACCAAGG + Intergenic
1078037999 11:7828073-7828095 ATGTCCACAAGCAGCAACAAGGG + Intergenic
1079103394 11:17555565-17555587 AAGGCCACACACAGAAAACTAGG - Intronic
1081401931 11:42653613-42653635 ATTGCCAAATAAAGCAACCATGG - Intergenic
1081527316 11:43935892-43935914 ATGGCCTCACCCAGCCACCCCGG - Intronic
1083698362 11:64457572-64457594 ATTGGCACATACAGCAACCATGG + Intergenic
1084091283 11:66880718-66880740 ATGGCCAGGCACAGGAAGCAGGG + Intronic
1084126742 11:67104030-67104052 ATGGCCTCAGGCAGCAAACAGGG - Intergenic
1084148317 11:67276484-67276506 ATGGCCATACCAAGCAACCCAGG + Intronic
1086101691 11:83106879-83106901 AAGGCCACCCACTGGAACCATGG + Intergenic
1088592009 11:111411597-111411619 ATGTGCACACAAATCAACCAAGG + Intronic
1090387733 11:126366324-126366346 ATGCCCACATACAGCTTCCAGGG - Intronic
1097287096 12:57886812-57886834 AAGGCCACTCTCAGCAACAAGGG + Intergenic
1097789827 12:63803491-63803513 AAGGCCACATCCCGCAACCAGGG - Intronic
1097982313 12:65746966-65746988 ATGGCCACTCCTAGCATCCAAGG + Intergenic
1101214326 12:102565452-102565474 ATGGCCACACATAGCTGCAAGGG - Intergenic
1102970301 12:117161149-117161171 CTGGCCGCACACAGGAACCAGGG + Intronic
1104065291 12:125300441-125300463 AGGGCCACACACAGGGGCCAAGG - Intronic
1104740433 12:131168125-131168147 ATGCTCACACCCAGCATCCAGGG - Intergenic
1105200669 13:18172178-18172200 ATGGCCACTGAAAGCAAGCATGG + Intergenic
1105662747 13:22516805-22516827 ATGGCCACACTCAGGTACAAGGG - Intergenic
1105847165 13:24303116-24303138 AGGTCCAAACACAGCATCCAGGG + Exonic
1108597240 13:51960096-51960118 AGGGCCACACACAGCATGGAAGG + Intronic
1113448035 13:110385540-110385562 CTATCCACACACTGCAACCACGG - Intronic
1113448073 13:110385780-110385802 CTATCCACACACTGCAACCACGG - Intronic
1113484704 13:110645552-110645574 ATGACCACACCAAGCACCCAGGG - Intronic
1115101766 14:29709780-29709802 ATGCCCACACACATCAAGGAGGG + Intronic
1118809891 14:69265400-69265422 AAGGACAAACACAGCCACCATGG - Intronic
1119875934 14:78059378-78059400 ATGGTCACATACATCAAGCATGG - Intergenic
1120181026 14:81342575-81342597 AGGGCCCCACACAGCACACAGGG - Intronic
1121334551 14:93069421-93069443 AGGGCCACACACAGCAGCTGGGG - Intronic
1121652733 14:95571696-95571718 ATGGCCTCACATAGCTACAAGGG - Intergenic
1122696558 14:103556097-103556119 ATGGCCACCAACTGCAGCCAAGG + Intergenic
1122813964 14:104303284-104303306 ATGGCCCCAGACAGCAAGCCCGG + Intergenic
1123663507 15:22587203-22587225 AAGGCCTGACACAGCATCCAAGG + Intergenic
1124317337 15:28681655-28681677 AAGGCCTGACACAGCATCCAAGG + Intergenic
1124566106 15:30815848-30815870 AAGGCCTGACACAGCATCCAAGG - Intergenic
1124595099 15:31085809-31085831 CTGGACACAGACAGCAGCCAGGG + Intronic
1125173324 15:36792200-36792222 ATGGCCCCATAGAGCCACCAGGG - Intronic
1127921622 15:63499021-63499043 ATGGCCACACCTAGCTACAAGGG + Intergenic
1129964520 15:79722089-79722111 ATGGCCAATCATAGCAACCAAGG + Intergenic
1131432486 15:92397807-92397829 ATGGGCACACACAGCATCCTTGG + Intronic
1131668409 15:94594761-94594783 ACGGCCACACACATCCAGCAAGG - Intergenic
1132028387 15:98421378-98421400 CGGGACACACGCAGCAACCACGG - Intergenic
1132515296 16:363238-363260 ATGGCCACACCCAGCAGCCTGGG - Intergenic
1133309319 16:4833297-4833319 ATGGCCACACACAGATCCCTGGG + Intronic
1135058342 16:19249789-19249811 ATGGCCAGAAACACCAACCAGGG - Intronic
1136013888 16:27382790-27382812 CTGGCCACACACAGGACCTAGGG + Intergenic
1136504169 16:30692210-30692232 ATGTCTCCACACAGCAGCCAGGG - Intergenic
1136932552 16:34432315-34432337 ATGGGCACACACAGCCACAGAGG - Intergenic
1136972020 16:34979499-34979521 ATGGGCACACACAGCCACAGAGG + Intergenic
1139491604 16:67288941-67288963 ATGGCCACACACATCAGAAAGGG - Exonic
1140357847 16:74321189-74321211 ATGGCCACATTCAGGAACCAGGG + Intergenic
1140504187 16:75460082-75460104 AGGGGCACACCCAGGAACCAGGG - Intronic
1140980436 16:80103938-80103960 ATGGGCAGACAAACCAACCAAGG - Intergenic
1142141641 16:88475295-88475317 GTGGGCACACACAGGGACCATGG + Intronic
1142270248 16:89085256-89085278 ATGTCAACACACAGGAAACACGG + Intergenic
1142407015 16:89895935-89895957 ATGGCCACACACAGCAACCACGG - Intronic
1143352834 17:6301534-6301556 CTGCCCACACATAGCAGCCAGGG - Intergenic
1146545452 17:33734245-33734267 CTGGCCACACACAGGAACACAGG - Intronic
1148187718 17:45656572-45656594 ATGTCCACACAGTGCATCCATGG + Intergenic
1150210087 17:63437096-63437118 GTTTCCACACACAGCATCCAAGG - Intronic
1151128114 17:71866955-71866977 ATGGTGACAGACACCAACCAAGG - Intergenic
1151490050 17:74427479-74427501 TTGGCCAGACACTGCAGCCAGGG + Intronic
1151727366 17:75892704-75892726 ATGGCCTCACACTGCATCCTGGG - Intronic
1151906954 17:77054944-77054966 CGGGCCACCCACAGCACCCAGGG + Intergenic
1152015040 17:77744926-77744948 AGGGCCAAACACAGCATCTAGGG + Intergenic
1152047824 17:77949751-77949773 TTGGCCACCCAGACCAACCATGG - Intergenic
1152613768 17:81328751-81328773 ATGGCCACACTGAGCACCCCTGG + Intronic
1153747472 18:8194564-8194586 ATGAGCACGCACAGCTACCATGG - Intronic
1158598041 18:58833513-58833535 ATGGCCACACATGGCTGCCAGGG - Intergenic
1160221262 18:76979695-76979717 ATGGCCTCACATAGGAAACAGGG - Intronic
1160510083 18:79448521-79448543 ATGGGCACACACAGCAAGTGTGG + Intronic
1160604102 18:80036052-80036074 ATGAACACACCCAGCACCCATGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1163129454 19:15263567-15263589 ATGGGCAGACACAGCTAACAGGG - Intronic
1164237884 19:23352778-23352800 ATGGACACCCAAAGCAAGCAGGG + Intronic
1166146077 19:40836514-40836536 ATGGCCTCAGACATCACCCAAGG - Intronic
1166150178 19:40867448-40867470 ATGGCCTCAGACATCACCCAAGG - Intronic
1168469983 19:56631843-56631865 ATGGCCACACCTAGCAGCAAGGG - Intergenic
925235638 2:2274986-2275008 ATGGCCACACACTGAGACCAGGG + Intronic
926297191 2:11577536-11577558 ATGGCCACAGTCAGCAACGCAGG + Intronic
926795325 2:16614482-16614504 GTGGCCACAGACAGCAGCCTGGG - Intronic
927064513 2:19457798-19457820 AGGGCCACACACAGGAAGAAAGG - Intergenic
928740728 2:34349078-34349100 GTAGCCACACACAGAGACCAAGG - Intergenic
930168569 2:48228712-48228734 TCGGGCACACACAGCATCCATGG + Intergenic
931651921 2:64476392-64476414 ATGGCCAAGCCCAGCAACCAAGG - Intergenic
932092075 2:68815171-68815193 ATGTCTACACACAGGGACCAAGG + Intronic
932835393 2:75031188-75031210 ATGGCTCCACACAGCCACCTCGG + Intergenic
937262944 2:120597997-120598019 ATGGCCACACCCAGCCACTAGGG - Intergenic
938378575 2:130824082-130824104 ATGGCCACACACAGCCACACTGG + Intergenic
944512615 2:200479491-200479513 ATGGCCACACCCAGGCTCCAGGG - Exonic
946296007 2:218783903-218783925 ATGGCCCCTCAGAGGAACCAGGG - Intronic
946688487 2:222294184-222294206 AAGGCCAAACACAGCATCGACGG - Exonic
947117141 2:226783777-226783799 ATAGCCACACCCAGCATCAAGGG - Intronic
948737689 2:240020091-240020113 ATGGACACACACTGCATCCGTGG + Intronic
948800152 2:240429808-240429830 CTGACCACACCCTGCAACCATGG - Intergenic
1170598981 20:17826506-17826528 AGGCCCACACAGAGGAACCAAGG - Intergenic
1170921417 20:20683209-20683231 ATGGCCACACAGACCAGGCAGGG - Intronic
1171179842 20:23084469-23084491 GTGGCCACACAAAACAACGATGG - Exonic
1172163617 20:32885491-32885513 ATCGCCTCCCACAGGAACCATGG + Exonic
1175003639 20:55658230-55658252 TTGGTCACACACACCAACCCTGG + Intergenic
1175321033 20:58088511-58088533 ATGGCCACTCCCAGCTGCCAGGG - Intergenic
1175945524 20:62556750-62556772 ATGGCCACACAAACCCACCTGGG - Intronic
1177262311 21:18747347-18747369 ATAGCCACACACAGAAACATAGG - Intergenic
1177867148 21:26525976-26525998 ATGGACACAGACAGGAACAATGG + Intronic
1178995675 21:37397144-37397166 ATGGCCATACCCAGCCACAAGGG + Intronic
1179304273 21:40140845-40140867 AGGGACAGACACAGCAACCTTGG + Intronic
1181339502 22:22166507-22166529 AGGGACACACACAGCAATCCTGG - Intergenic
1182477180 22:30582642-30582664 ATGGGCACACCCGGCACCCATGG - Intronic
1184159561 22:42689891-42689913 ATGGCCACAGCCAGCTGCCAAGG + Intergenic
1184530398 22:45051723-45051745 ATGGCCACGCACAGTACTCAGGG - Intergenic
949834687 3:8255068-8255090 CTGCCAACACACAGCAGCCAGGG - Intergenic
950227049 3:11244316-11244338 ATGGTCACACCCAGCTACAAAGG + Intronic
950886628 3:16368038-16368060 ATGGCCACAGATAGCATCTATGG + Intronic
953355395 3:42251993-42252015 GTGGCCACACACACAAACCTCGG + Intergenic
954116369 3:48469004-48469026 CTGGACACACACAGCACACATGG + Exonic
954386376 3:50246191-50246213 CTCGGCACACACAGAAACCATGG - Intronic
954867720 3:53744052-53744074 CTGGCCACACTCAGCCACCTAGG + Intronic
955257550 3:57349299-57349321 ATGGCCACACACAAAAAAAATGG + Intronic
956699090 3:71942910-71942932 AAGGCCACAGACTGCTACCAGGG - Intergenic
956852750 3:73245823-73245845 ATGACCACACACAGCTGCAAGGG - Intergenic
956877339 3:73476554-73476576 TTGGTCACACACAACAACCTTGG - Intronic
958516037 3:95117087-95117109 ATGCCCACACCCAGCTGCCAAGG - Intergenic
959307104 3:104681443-104681465 AAGACCACACACAGAATCCAAGG + Intergenic
960640204 3:119816229-119816251 ATGGCCACTCCCAGCATCCCAGG - Intronic
962102454 3:132356834-132356856 ATGACCACAAACAGCCATCAAGG + Exonic
963899775 3:150723082-150723104 AAGGACAAAGACAGCAACCATGG + Intergenic
964008192 3:151856555-151856577 ACGGACACACACAGAAACAATGG - Intergenic
964454773 3:156850791-156850813 ATTGCCAAACATAGCAGCCAGGG + Intronic
965239594 3:166177816-166177838 ATGGACACAGACAGCTACAAGGG + Intergenic
966878530 3:184336843-184336865 ATGGCCACCCACGGAAACCGAGG - Intronic
968551204 4:1224126-1224148 GTGGGCACGCACATCAACCACGG - Intronic
968578943 4:1380781-1380803 TTGGGCACAAACAGCGACCAGGG - Intronic
969318904 4:6398925-6398947 ATTGACACACACAGCAACCAGGG + Intronic
973589621 4:52427644-52427666 ATGGCCACACCCAGCTGCAAGGG + Intergenic
973705196 4:53573946-53573968 TTGGCCACACACTGCACACAGGG + Exonic
977251607 4:94694872-94694894 TTGGCCAAACACAGTAAGCATGG - Intergenic
979459913 4:120970240-120970262 ATAGCCACACATTCCAACCAGGG - Intergenic
981551870 4:145949906-145949928 ATGGGAAAACACAGCAACAATGG - Intergenic
982285664 4:153731520-153731542 ATGGCAACACAAAGAAACCATGG - Intronic
985590493 5:761987-762009 ATGGCCACTCACAGCCAAGAGGG + Intronic
985590553 5:762271-762293 ATGGCCACTCACAGCCTCAACGG + Intronic
985816412 5:2131334-2131356 ACGGCCACACACAGCACCTGCGG + Intergenic
986690655 5:10311058-10311080 TTGGTCACACAGACCAACCATGG - Intergenic
988786602 5:34570956-34570978 ATGGCCAAGCCCACCAACCAGGG + Intergenic
989554238 5:42773510-42773532 ATGGCCATACACTGAAACTAGGG - Intronic
990755104 5:59059980-59060002 ATGGCAACACCTGGCAACCAAGG - Intronic
992551803 5:77866440-77866462 ATGGCCACATGCAGCCACCCTGG - Intronic
992788162 5:80189499-80189521 ATGGCCCCACACAGAATACAGGG + Intronic
993060818 5:83036688-83036710 ATTGCCACACACAGAAGCCAAGG - Intergenic
995410303 5:111849767-111849789 ATGGCCACACCTAGCTACAAGGG - Intronic
995472798 5:112521441-112521463 ATGGACACCAACAGCAAGCAGGG - Intergenic
995933740 5:117483758-117483780 ATGGCAAAACACAGCATCCACGG - Intergenic
996737308 5:126769866-126769888 ATGGCAACCCACAGCCCCCAGGG - Intergenic
996873444 5:128216527-128216549 TTGGCCACACACAGCAATCCGGG + Intergenic
997883976 5:137614525-137614547 ATGGACACACACAGAAACACAGG - Intergenic
998219213 5:140262472-140262494 ATGGCTTCACACAGAATCCATGG + Intronic
998437211 5:142121575-142121597 ATGGCCTTACAAAGCAACTAAGG - Intronic
999113609 5:149142381-149142403 ATGGCCACACACTGCTTCCTAGG - Intronic
1001015652 5:168138720-168138742 AAAGCCACACACATCATCCATGG + Intronic
1001149059 5:169210904-169210926 ATGGCCACACCCAACATCAATGG - Intronic
1002588778 5:180272665-180272687 ATAGCTACATACAGCAACAATGG - Intronic
1006280525 6:33049582-33049604 CAGGCCACACACAGACACCAAGG - Intergenic
1007647856 6:43396621-43396643 ATGGCCACTTACATCAACTACGG - Intergenic
1008775212 6:55030187-55030209 ATGGACACCAAAAGCAACCAGGG - Intergenic
1008936838 6:57000751-57000773 ATGGCCTCAGACATCACCCAAGG - Intronic
1009326160 6:62349966-62349988 ATGGCCACACTTAGCTACAAAGG + Intergenic
1009969045 6:70606843-70606865 ATGGACACAAAAAGCAAGCAGGG + Intergenic
1011874577 6:91941701-91941723 AGGCCCACACACAGAAAACAAGG + Intergenic
1017036772 6:150274143-150274165 ATAGCCACACACATCTCCCAGGG + Intergenic
1019146679 6:169980015-169980037 ATGCCCAGACACAGCCAGCACGG + Intergenic
1020022912 7:4879693-4879715 AGGGCCACAGAAAGCAACCAGGG + Intronic
1020373948 7:7463981-7464003 ATGGACACCAAAAGCAACCAGGG + Intronic
1021609605 7:22444589-22444611 TTGGCCACTCGCAGCAACCCTGG + Intronic
1022390205 7:29937204-29937226 ATGGCCACACATAGTCACAAGGG - Intronic
1023496216 7:40800201-40800223 AAGGCCACACCCATCATCCAAGG - Intronic
1023853407 7:44163675-44163697 TTGGACACTTACAGCAACCATGG + Intronic
1024346326 7:48318203-48318225 GTGACCTCACACAGCAACCATGG - Intronic
1026796308 7:73368151-73368173 AGGGCCACAAACAGCATCAAAGG - Intergenic
1026888421 7:73968019-73968041 CTGGCCACACCCATCATCCAGGG - Intergenic
1029234220 7:99099761-99099783 ATGGCCAGAGAGAGAAACCAAGG - Intronic
1029243940 7:99184903-99184925 AGTGGCGCACACAGCAACCATGG - Intronic
1029595048 7:101533303-101533325 AAGGCCACCCAGAGCCACCAAGG - Intronic
1030927112 7:115472088-115472110 ATGGGCAGACCCAGAAACCAGGG - Intergenic
1032474880 7:132204869-132204891 TTGCCCTCATACAGCAACCACGG + Intronic
1032646471 7:133830287-133830309 ATGGGCAAACACAGCAAGCAAGG - Intronic
1033622237 7:143072038-143072060 ATGGCCAAATATAGCAACAATGG + Intergenic
1033761046 7:144437087-144437109 ATGGCCAGACAAATCACCCAAGG - Intergenic
1034299512 7:150002887-150002909 ATGGGCACACACAGGACCCAGGG + Intergenic
1035097393 7:156366497-156366519 ATGGCCATTCACAGCAGCCACGG + Intergenic
1036799161 8:11776954-11776976 CTGGTCAGACACAGCAGCCAGGG - Intronic
1037383440 8:18312703-18312725 ATGACCATACTCAGCTACCAGGG - Intergenic
1037722870 8:21459746-21459768 AGTGCCACTCACAGCAACCTGGG - Intergenic
1038346926 8:26741370-26741392 AAAGCCACACAGAGCAACCCAGG - Intergenic
1039197015 8:35043933-35043955 AAGGCCATAGGCAGCAACCAGGG - Intergenic
1039677013 8:39679431-39679453 ATGGCAAAATACAGCATCCATGG + Intronic
1039781054 8:40786034-40786056 ATGACAAAACACAGCAGCCAAGG + Intronic
1042247907 8:66726301-66726323 GTTGCCACAAACAGCAACCTTGG - Intronic
1043270905 8:78331600-78331622 ATGGACACCAAAAGCAACCAGGG + Intergenic
1044099784 8:88120498-88120520 ATGCCCACACCCAGAAAACATGG + Intronic
1045257134 8:100535713-100535735 ATGGATACACACAGCTACCCTGG - Intronic
1046626835 8:116584291-116584313 ATCTCCACACACACAAACCATGG + Intergenic
1047448376 8:124939625-124939647 TTGGCCACACCCAGCAGCAAGGG - Intergenic
1049124791 8:140777126-140777148 ATGGCCTAATACAGCAAACAAGG - Intronic
1049503878 8:142984573-142984595 GTGGCCACACGCAGCCAGCAGGG - Intergenic
1050009712 9:1173090-1173112 ATGGCTGCACTCAGAAACCAGGG - Intergenic
1051366667 9:16326113-16326135 CTGGCAGCACACAGCAGCCACGG + Intergenic
1051595571 9:18821507-18821529 ATGGCCACGCACAACTACAAAGG + Intronic
1052267949 9:26595835-26595857 GTGGGAACTCACAGCAACCAGGG - Intergenic
1053030918 9:34777315-34777337 ATGCCAGCACACACCAACCAGGG - Intergenic
1054741659 9:68811941-68811963 GGGGCCACACACTGAAACCAGGG - Intronic
1056016349 9:82392257-82392279 ATGGGCACACACAATGACCAGGG - Intergenic
1056699350 9:88889140-88889162 CTGGCCACACACAAAAACAACGG + Intergenic
1058703857 9:107622931-107622953 CTGGCCAAACACAGCAGCAAGGG + Intergenic
1061378592 9:130240764-130240786 ATGGCCGCACTCAGCCACAAGGG - Intergenic
1061810668 9:133161196-133161218 GTGGCCAGACACAGCAAGCAAGG + Intronic
1061898356 9:133660190-133660212 GTGGCAACTCTCAGCAACCACGG - Intergenic
1062316752 9:135971131-135971153 AGGGCGACTCCCAGCAACCAGGG + Intergenic
1203583684 Un_KI270746v1:41761-41783 ATGGCCACTGAAAGCAAGCATGG - Intergenic
1185461801 X:336301-336323 ATGGACACACAGAGGAACCACGG + Intronic
1185619298 X:1443651-1443673 ATGGACACACACCGCCATCATGG + Intronic
1186792109 X:13009490-13009512 ATGGCCTCATACAGAAACCCTGG - Intergenic
1187796549 X:23010217-23010239 ATAGACACACACACTAACCATGG + Intergenic
1190871285 X:54426727-54426749 ACAGCCATACACAGCAGCCAAGG - Intergenic
1191936920 X:66436728-66436750 ATGGCCAGACACAGAACCCCAGG + Intergenic
1193106146 X:77676153-77676175 ATGGGCACAAACAGCAGCAACGG - Intronic
1199932886 X:152542575-152542597 ATGGCAATACAAAGCAACAATGG - Intergenic
1200084462 X:153596800-153596822 ATGGCCACAGCCAGGCACCAGGG + Intronic
1200228013 X:154429907-154429929 ATCTGCCCACACAGCAACCAAGG - Intronic