ID: 1142407686

View in Genome Browser
Species Human (GRCh38)
Location 16:89900186-89900208
Sequence GGCAAGAGAAACTGGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1648
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 1619}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142407686 Original CRISPR GGCAAGAGAAACTGGCACGG TGG Intronic
900750129 1:4390455-4390477 GGCAAGAGAAGGAGGCAGGGAGG - Intergenic
901030877 1:6306092-6306114 GGCAGGAGAATCAGGCAGGGAGG + Intronic
901100674 1:6716177-6716199 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
901147187 1:7073188-7073210 GGCCAGAGTCACTGGCAGGGTGG + Intronic
901224115 1:7601844-7601866 GGCAGGAGAATCAGGCAGGGAGG + Intronic
901270825 1:7952169-7952191 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
901555455 1:10028454-10028476 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
901734970 1:11306474-11306496 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
901850026 1:12009103-12009125 GGCAGGAGAATCAGGCAGGGAGG + Intronic
901855651 1:12042766-12042788 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
901970233 1:12902486-12902508 GGCAGGAGAATCAGGCAGGGAGG - Intronic
902014934 1:13299283-13299305 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
902018502 1:13327730-13327752 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
902062452 1:13657481-13657503 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903081201 1:20814875-20814897 GGCAGGAGAATCAGGCAGGGAGG - Intronic
903100202 1:21023361-21023383 GGCAGGAGAATCAGGCAGGGAGG - Intronic
903103253 1:21052673-21052695 GGCAGGAGAATCAGGCAGGGAGG - Intronic
903147885 1:21387141-21387163 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903176700 1:21585834-21585856 GGCAGGAGAAACTGGAGCTGTGG + Intergenic
903458171 1:23503361-23503383 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903485684 1:23688280-23688302 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903508006 1:23852568-23852590 GGCAGGAGAATCAGGCAGGGAGG - Intronic
903519275 1:23935083-23935105 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903531362 1:24032781-24032803 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
903633765 1:24798748-24798770 GGCAGGAGAATCAGGCAGGGAGG - Intronic
903638134 1:24834724-24834746 GGCAGGAGAATCAGGCAGGGAGG + Intronic
903748301 1:25603352-25603374 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903848983 1:26295156-26295178 GACAGGAAAACCTGGCACGGGGG - Intronic
903894599 1:26595569-26595591 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
903921783 1:26804758-26804780 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
903961955 1:27063538-27063560 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
904077182 1:27852240-27852262 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
904761149 1:32805131-32805153 GGCAGGAGAATCAGGCAGGGAGG + Intronic
904930146 1:34081511-34081533 GGCAGGAGAATCAGGCAGGGAGG - Intronic
905315445 1:37079871-37079893 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
905427200 1:37895605-37895627 GGCAGGAGAATCAGGCAGGGAGG - Intronic
905526918 1:38646901-38646923 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
905673332 1:39807778-39807800 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
905686775 1:39913919-39913941 GGCAAGAGAATCAGGCAGGGAGG + Intergenic
905699172 1:39999146-39999168 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
906136008 1:43501376-43501398 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
906308693 1:44738135-44738157 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
906329814 1:44875877-44875899 GGCAGGAGAATCAGGCAGGGAGG - Intronic
906353237 1:45081403-45081425 GGCAGGAGAATCAGGCAGGGAGG - Intronic
906357132 1:45116010-45116032 GGCAGGAGAATCAGGCAGGGAGG + Intronic
906370218 1:45247562-45247584 GGCAGGAGAATCAGGCAGGGAGG - Intronic
906427043 1:45724074-45724096 GGCAGGAGAATCAGGCAGGGAGG - Intronic
906741803 1:48191844-48191866 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
906762069 1:48384239-48384261 GGCAGGAGAATCAGGCAGGGAGG + Intronic
906770467 1:48478830-48478852 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
906956673 1:50381105-50381127 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
907009697 1:50952200-50952222 GGCAGGAGAATCAGGCAGGGAGG - Intronic
907089793 1:51712305-51712327 GGCAGGAGAATCAGGCAGGGAGG + Intronic
907140416 1:52181175-52181197 GGCAGGAGAATCAGGCAGGGAGG - Intronic
907402295 1:54232685-54232707 GGCAGGAGAATCAGGCAGGGAGG - Intronic
908370048 1:63472563-63472585 GGCAGGAGAATCAGGCAGGGAGG - Intronic
908445995 1:64200557-64200579 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
908467702 1:64414341-64414363 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
909479172 1:76113242-76113264 GGCAGGAGAATCAGGCAGGGAGG + Intronic
909641292 1:77870989-77871011 GGCAGGAGAATCAGGCAGGGAGG + Intronic
910343622 1:86215205-86215227 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
910412858 1:86964541-86964563 GGCAGGAGAATCAGGCAGGGAGG + Intronic
910777677 1:90892442-90892464 GGCAGGAGAATCAGGCAGGGGGG + Intergenic
910815864 1:91289763-91289785 GGCAGGAGAATCAGGCAGGGAGG + Intronic
911326007 1:96470496-96470518 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
911351942 1:96763481-96763503 GGCAGGAGAATCAGGCAGGGAGG + Intronic
911486844 1:98513515-98513537 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
911534146 1:99079357-99079379 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
911598435 1:99823048-99823070 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
911602189 1:99857715-99857737 GGCAGGAGAATCAGGCAGGGAGG + Intronic
912266322 1:108160853-108160875 GGCAGGAGAATCAGGCAGGGAGG + Intronic
912298680 1:108490722-108490744 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
912303090 1:108536721-108536743 GGCAGGAGAACCAGGCAGGGGGG + Intergenic
912316825 1:108675173-108675195 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
912669239 1:111608804-111608826 GGCAGGAGAACCAGGCAGGGAGG + Intronic
912844180 1:113064280-113064302 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
913021297 1:114791368-114791390 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
913306375 1:117431102-117431124 GGCAGGAGAATCAGGCAGGGAGG + Intronic
913993605 1:143637168-143637190 GGCAGGAGAATCAGGCATGGAGG - Intergenic
914001973 1:143702156-143702178 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
914230829 1:145764006-145764028 GGCAGGAGAATCAGGCAGGGAGG - Intronic
914231683 1:145767876-145767898 GGCAGGAGAATCAGGCAGGGAGG + Intronic
914374458 1:147061377-147061399 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
914392031 1:147232591-147232613 GGCAGGAGAATCAGGCAGGGAGG - Intronic
914468478 1:147950836-147950858 GGCAGGAGAATCAGGCAGGGAGG + Intronic
914775433 1:150729878-150729900 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
914780432 1:150780968-150780990 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
914787801 1:150850374-150850396 GGCAGGAGAATCAGGCAGGGAGG - Intronic
914887850 1:151599681-151599703 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
914909124 1:151769975-151769997 GGCAGGAGAATCAGGCAGGGAGG + Intronic
914954095 1:152145541-152145563 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
914960043 1:152197127-152197149 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
914965962 1:152257052-152257074 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
914987466 1:152472659-152472681 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
915112643 1:153574566-153574588 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
915113728 1:153582407-153582429 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
915502195 1:156327383-156327405 GGCAGGAGAATCAGGCAGGGAGG - Intronic
915616299 1:157042147-157042169 GGGAAGAGAATCAGGCAGGGTGG + Intronic
915861427 1:159449281-159449303 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
916037189 1:160932754-160932776 GGCAGGAGAAAAAGGCAGGGAGG - Intergenic
916049904 1:161029060-161029082 GGCAGGAGAATCAGGCAGGGAGG - Intronic
916087638 1:161282290-161282312 GGCAGGAGAATCAGGCAGGGAGG + Intronic
916223276 1:162465495-162465517 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
916671870 1:167029339-167029361 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
916714251 1:167435861-167435883 GGCAAGATAAACTTGGATGGTGG + Intronic
916800165 1:168208514-168208536 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
917006027 1:170418344-170418366 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
917126800 1:171694552-171694574 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
917205801 1:172571151-172571173 GGCAGGAGAATCAGGCAGGGAGG - Intronic
917376252 1:174350983-174351005 GGCAGGAGAATCAGGCAGGGAGG + Intronic
917553165 1:176057427-176057449 GGCAGGAGAATCAGGCAGGGGGG - Intronic
917848583 1:179041529-179041551 GGCAGGAGAATCAGGCAGGGAGG + Intronic
917859741 1:179134822-179134844 GGCAGGAGAATCAGGCAGGGAGG - Intronic
917889292 1:179419517-179419539 GGCAGGAGAATCAGGCAGGGAGG + Intronic
918172328 1:182010319-182010341 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
918221560 1:182440540-182440562 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
918228937 1:182510571-182510593 GGCAGGAGAATCAGGCAGGGAGG + Intronic
918255501 1:182742642-182742664 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
918812642 1:189140515-189140537 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
918818669 1:189225145-189225167 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
919423744 1:197405168-197405190 GGCAGGAGAATCAGGCAGGGAGG - Intronic
919700753 1:200628822-200628844 GGAAAGAGACACAGGCAGGGAGG + Intronic
919728385 1:200898160-200898182 GGCAGGAGATTCTGGCACTGGGG - Intronic
919926049 1:202192389-202192411 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
919959562 1:202452453-202452475 GGCAGGAGAATCAGGCAGGGAGG + Intronic
920144052 1:203842501-203842523 GGCAGGAGAATCAGGCAGGGAGG + Intronic
920205139 1:204285975-204285997 AGCAGGAGAAGCTGGCATGGAGG + Intronic
920396828 1:205652759-205652781 TACAAGAGAAATGGGCACGGTGG + Intergenic
920451360 1:206063484-206063506 GGCAGGAGAATCAGGCAGGGAGG - Intronic
920794787 1:209128570-209128592 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
921109004 1:212014638-212014660 GGCAGGAGAATCAGGCAGGGAGG - Intronic
921142841 1:212322091-212322113 GGCAGGAGAATCAGGCAGGGAGG + Intronic
921192633 1:212724338-212724360 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
921197945 1:212778491-212778513 GGCAGGAGAATCAGGCAGGGAGG - Intronic
921638582 1:217524764-217524786 GGCAGGAGAATCAGGCAGGGAGG + Intronic
921813900 1:219545097-219545119 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
921902935 1:220467421-220467443 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
922102307 1:222487091-222487113 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
922278373 1:224100309-224100331 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
922306669 1:224350566-224350588 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
922436811 1:225615135-225615157 GGCAGGAGAATCAGGCAGGGAGG - Intronic
922503997 1:226115852-226115874 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
922632656 1:227132232-227132254 GGCAGGAGAATCAGGCAGGGAGG - Intronic
922644738 1:227275695-227275717 GGCAGGAGAATCAGGCAGGGAGG - Intronic
922693341 1:227711754-227711776 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
922993142 1:229932468-229932490 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
923136948 1:231127992-231128014 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
923174741 1:231453647-231453669 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
923328485 1:232901023-232901045 GGCCGCAGAAACTGGCACCGAGG + Intergenic
923539643 1:234878631-234878653 GGCAAGGGAAACTTGAACGAAGG + Intergenic
923589728 1:235308567-235308589 GGCAGGAGAATCAGGCAGGGAGG - Intronic
923710624 1:236386016-236386038 GGCAGGAGAATCAGGCAGGGAGG - Intronic
923716508 1:236429039-236429061 GGCAGGAGAATCAGGCAGGGAGG + Intronic
923841006 1:237670192-237670214 GGCAGGAGAATCAGGCAGGGAGG + Intronic
924634677 1:245774793-245774815 GGCAGGAGAATCAGGCAGGGAGG - Intronic
924765830 1:247031657-247031679 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
924788257 1:247220081-247220103 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
924925494 1:248676393-248676415 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
924943603 1:248829863-248829885 GGCAAGAGAATCAGGCAGGGAGG - Intergenic
1063084822 10:2806883-2806905 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1063459732 10:6207340-6207362 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1063744785 10:8868472-8868494 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1063776901 10:9273890-9273912 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1064108813 10:12520832-12520854 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1064109249 10:12523648-12523670 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1065055190 10:21837003-21837025 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1065594564 10:27297386-27297408 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1065737909 10:28771262-28771284 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1065840212 10:29696044-29696066 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1065997237 10:31070302-31070324 GGAAAGGGAAACTGGCAGAGGGG + Intergenic
1066085168 10:31969176-31969198 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1066140665 10:32500949-32500971 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1066250282 10:33626374-33626396 GGAAAGAGAACATGGCACTGGGG + Intergenic
1066325219 10:34352438-34352460 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1066390767 10:34976048-34976070 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1066952761 10:42137635-42137657 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1067026310 10:42846794-42846816 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1067033462 10:42896512-42896534 GGCAAGAGAGAAAGGCAAGGAGG + Intergenic
1067114267 10:43422727-43422749 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1067117587 10:43447092-43447114 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1067325033 10:45259409-45259431 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1067331994 10:45330812-45330834 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1067339627 10:45391185-45391207 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1067354315 10:45511500-45511522 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1067391390 10:45866268-45866290 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1067511227 10:46896431-46896453 GGCAACAGAAACTGTCACACTGG + Intergenic
1067651026 10:48155431-48155453 GGCAACAGAAACTGTCACACTGG - Intergenic
1067871900 10:49969883-49969905 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1067911952 10:50355367-50355389 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1068667838 10:59696196-59696218 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1068673101 10:59743757-59743779 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1068969444 10:62947117-62947139 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1069052853 10:63812367-63812389 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1069157700 10:65051824-65051846 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1069365497 10:67690984-67691006 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1069601273 10:69709747-69709769 TGCCACAGAAACTGGGACGGAGG - Intergenic
1069645606 10:69993772-69993794 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1069732824 10:70630518-70630540 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1069741610 10:70688760-70688782 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1069929122 10:71870348-71870370 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1069930200 10:71876599-71876621 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1070367589 10:75751218-75751240 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1070629815 10:78076560-78076582 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1070684305 10:78469587-78469609 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1070807663 10:79279865-79279887 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1070966317 10:80533481-80533503 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1071289874 10:84180989-84181011 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1071311629 10:84348355-84348377 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1071501772 10:86209327-86209349 GCCAAGAGAATTTGGCACAGAGG - Intronic
1071538195 10:86454470-86454492 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1071616311 10:87080030-87080052 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1072180156 10:92974658-92974680 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1072291561 10:93970132-93970154 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1072602556 10:96942346-96942368 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1072684771 10:97529648-97529670 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1072730193 10:97841102-97841124 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1072772244 10:98152045-98152067 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1072956323 10:99891276-99891298 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1072980008 10:100092283-100092305 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1072999528 10:100276594-100276616 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1073238081 10:102035496-102035518 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1073275004 10:102302168-102302190 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1073325453 10:102642316-102642338 GGCGAAAGAAACGGGCGCGGTGG - Intergenic
1073385889 10:103128168-103128190 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1073450523 10:103606587-103606609 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1074152301 10:110768133-110768155 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1075051153 10:119183101-119183123 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1075108689 10:119560338-119560360 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1075128652 10:119721450-119721472 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1075137357 10:119795981-119796003 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1075181601 10:120215945-120215967 GGCAGGAGAATCAGGCAGGGGGG + Intergenic
1075243247 10:120798034-120798056 GGCAGGAGAATCAGGCAGGGGGG - Intergenic
1075407443 10:122204061-122204083 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1075510274 10:123066841-123066863 GGCAAGAGGGAATGGCATGGGGG + Intergenic
1075842639 10:125517861-125517883 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1075893066 10:125970717-125970739 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1076011899 10:126995543-126995565 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1076914486 10:133415069-133415091 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1077397385 11:2331850-2331872 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1077607222 11:3620424-3620446 GGCAAGAGAAAAGGACAGGGAGG - Intergenic
1077684898 11:4282662-4282684 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1077690292 11:4335268-4335290 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1077839519 11:5960352-5960374 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1078122261 11:8522884-8522906 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1078176723 11:8977460-8977482 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1079018186 11:16887486-16887508 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1079020438 11:16906413-16906435 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1079040058 11:17051441-17051463 GGCAGGAGAACCAGGCAGGGAGG + Intergenic
1079173768 11:18120550-18120572 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1079372164 11:19860934-19860956 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1079444670 11:20547840-20547862 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1079479422 11:20864011-20864033 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1080097778 11:28429460-28429482 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1080405118 11:31971914-31971936 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1080538243 11:33243179-33243201 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1080620732 11:33985646-33985668 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1080859912 11:36144021-36144043 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1081288505 11:41303190-41303212 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1081627168 11:44663034-44663056 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1082064943 11:47892382-47892404 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1082166603 11:48956429-48956451 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1082233897 11:49799108-49799130 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1082259083 11:50063660-50063682 GGCAGGAGAATCAGGCAGGGGGG + Intergenic
1082706066 11:56496653-56496675 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1082844950 11:57717606-57717628 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1082871153 11:57944536-57944558 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1083042124 11:59699139-59699161 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1083079330 11:60073838-60073860 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1083120651 11:60509696-60509718 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1083208416 11:61167158-61167180 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1083382131 11:62278023-62278045 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1083646359 11:64173350-64173372 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1083831891 11:65238721-65238743 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1083865304 11:65450487-65450509 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1083918151 11:65763572-65763594 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1083991425 11:66248233-66248255 AGTAAGGGAAACTGGCAGGGCGG - Intergenic
1084048760 11:66587089-66587111 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1084338557 11:68476366-68476388 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1084388653 11:68860941-68860963 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1084624607 11:70296585-70296607 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1084839101 11:71830918-71830940 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1084884636 11:72195708-72195730 TGCAAGAGCAACTGGCACAAGGG + Exonic
1084887604 11:72221272-72221294 TGCAAGAGCAACTGGCACAGAGG + Exonic
1084924972 11:72503433-72503455 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1084992161 11:72936928-72936950 GGCAAGAGAAACTGTCTCCAAGG - Intronic
1084998227 11:73004506-73004528 GGCAAGAGACAATGGAAAGGGGG - Intronic
1085050036 11:73375708-73375730 GGCATTGGAAACTGGCAGGGTGG + Intergenic
1085097658 11:73774513-73774535 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1085112208 11:73898086-73898108 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1085116874 11:73937576-73937598 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1085270567 11:75267451-75267473 AGGAAGAGGAACAGGCACGGAGG + Intronic
1085360286 11:75878764-75878786 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1085443491 11:76583210-76583232 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1085480721 11:76820902-76820924 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1085492651 11:76934588-76934610 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1085513547 11:77099622-77099644 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1085563041 11:77489541-77489563 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1085618964 11:78023075-78023097 GGCAGGAGAAACTGGAAGGGAGG + Intronic
1085754331 11:79191219-79191241 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1085791174 11:79499348-79499370 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1086017059 11:82181295-82181317 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1086122763 11:83317700-83317722 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1086365919 11:86110031-86110053 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1086446684 11:86878355-86878377 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1086881332 11:92156994-92157016 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1087029027 11:93683596-93683618 AGCAAGAGGACCTGGCACGTAGG + Exonic
1087057532 11:93948139-93948161 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1087198481 11:95321969-95321991 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1087214598 11:95481910-95481932 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1087487136 11:98770658-98770680 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1088116433 11:106318169-106318191 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1088256964 11:107911897-107911919 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1088659097 11:112027803-112027825 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1088843615 11:113647018-113647040 GGGAAGAGATACTGGCCAGGGGG + Intergenic
1089358222 11:117869645-117869667 GGGAAGAGAAACTTGGACAGAGG + Intronic
1089421274 11:118332629-118332651 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1089510305 11:118992420-118992442 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1089520546 11:119059822-119059844 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1089585805 11:119508775-119508797 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1090106054 11:123854581-123854603 GGCCAGAGATACTGACAAGGTGG + Intergenic
1090152932 11:124404016-124404038 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1090227716 11:125081659-125081681 GGCAAGAGACACTGGCTCCCAGG - Intronic
1090322745 11:125862311-125862333 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1090686530 11:129128676-129128698 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1090762328 11:129848416-129848438 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1090785618 11:130044784-130044806 GGCAGGAGAACCAGGCAGGGAGG + Intergenic
1090791327 11:130092614-130092636 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1091286174 11:134409769-134409791 GACAAGAGACAAAGGCACGGAGG - Intronic
1091378417 12:41350-41372 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1091586050 12:1817576-1817598 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1092331637 12:7591047-7591069 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1092453384 12:8624449-8624471 GGCAGGAGAACCAGGCAGGGAGG - Intergenic
1092590804 12:9952278-9952300 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1092828017 12:12415453-12415475 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1092843677 12:12565502-12565524 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1092850157 12:12618942-12618964 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1093038366 12:14354165-14354187 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1093378210 12:18457099-18457121 GGATAGAGAAACTGGCTGGGAGG + Intronic
1094103095 12:26784443-26784465 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1094209261 12:27873424-27873446 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1094239218 12:28201931-28201953 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1094670513 12:32563904-32563926 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1094707244 12:32926117-32926139 GATAAGAAAAACTGGCACTGAGG + Intergenic
1094717110 12:33023532-33023554 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1095068986 12:37815811-37815833 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1095114046 12:38331176-38331198 GGCAGGAGAATCGGGCAGGGAGG + Intergenic
1095281255 12:40353887-40353909 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1095570923 12:43684461-43684483 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1096039573 12:48501412-48501434 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1096041578 12:48521251-48521273 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1096044519 12:48551331-48551353 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1096063815 12:48724158-48724180 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1096082245 12:48841553-48841575 GGCACGAGAATCAGGCAGGGAGG - Intronic
1096093171 12:48916503-48916525 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1096167725 12:49437732-49437754 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1096224816 12:49860325-49860347 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1096556866 12:52409164-52409186 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1096695377 12:53345210-53345232 GGCATGAGAGACTGGCAGGCTGG - Intronic
1096856820 12:54489146-54489168 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1096968812 12:55649061-55649083 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1097028695 12:56076629-56076651 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1097127269 12:56784580-56784602 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1097128268 12:56790456-56790478 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1097148954 12:56962939-56962961 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1097228767 12:57495903-57495925 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1097230697 12:57508564-57508586 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1097721516 12:63026485-63026507 GGCAAGAGAAACTGCTTCCGAGG + Intergenic
1097779410 12:63686250-63686272 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1098018798 12:66134025-66134047 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1098176634 12:67798967-67798989 GTCAAGAGAAAATGACAAGGTGG + Intergenic
1098307635 12:69117496-69117518 ACCAAGAGAAAATGGCACAGAGG - Intergenic
1098333275 12:69375805-69375827 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1098371068 12:69760283-69760305 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1098412447 12:70201223-70201245 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1098883585 12:75941135-75941157 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1099255691 12:80308870-80308892 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1100048104 12:90410664-90410686 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1100507710 12:95236326-95236348 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1100570912 12:95842279-95842301 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1100577772 12:95908365-95908387 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1100581856 12:95946718-95946740 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1100606756 12:96158197-96158219 GGCAGGAGAACCAGGCAGGGAGG - Intergenic
1100995411 12:100295602-100295624 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1101885036 12:108655472-108655494 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1102089183 12:110172479-110172501 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1102162313 12:110779400-110779422 ATCAAGAGAAACTGACATGGAGG + Intergenic
1102186517 12:110951759-110951781 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1102268141 12:111506756-111506778 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1102294368 12:111724697-111724719 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1102323140 12:111956606-111956628 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1102656429 12:114485518-114485540 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1103045245 12:117730601-117730623 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1103234660 12:119361039-119361061 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1103300048 12:119919628-119919650 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1103414224 12:120733125-120733147 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1103456884 12:121075430-121075452 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1103476699 12:121223940-121223962 TGCGAGTGAAGCTGGCACGGCGG - Intronic
1103536068 12:121634608-121634630 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1103591101 12:121993070-121993092 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1103641547 12:122356730-122356752 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1103872805 12:124102846-124102868 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1104713022 12:130998077-130998099 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1104861579 12:131926969-131926991 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1105248354 13:18673412-18673434 GGCAGGAGAATCAGGCAAGGAGG - Intergenic
1105367535 13:19778474-19778496 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1105555791 13:21447385-21447407 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1105692993 13:22859805-22859827 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1105921929 13:24971087-24971109 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1105976978 13:25481059-25481081 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1106293722 13:28390736-28390758 GGCAAGTGACACTGGCAAGTGGG + Intronic
1106495081 13:30269174-30269196 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1106560367 13:30840496-30840518 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1106679991 13:31999572-31999594 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1106746652 13:32715751-32715773 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1106747850 13:32722259-32722281 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1106799384 13:33241633-33241655 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1106918416 13:34539936-34539958 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1107042699 13:35966597-35966619 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1107165675 13:37279745-37279767 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1107492951 13:40899841-40899863 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1107498709 13:40954540-40954562 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1107562547 13:41571441-41571463 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1107589067 13:41882707-41882729 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1107692313 13:42965886-42965908 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1107953513 13:45486204-45486226 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1108024283 13:46162392-46162414 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1108330071 13:49377494-49377516 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1108348001 13:49565107-49565129 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1108351160 13:49592244-49592266 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1108501808 13:51077242-51077264 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1108608397 13:52063165-52063187 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1108685738 13:52817565-52817587 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1109156875 13:58922209-58922231 GGGAAGAGAAACTGAAAAGGAGG - Intergenic
1110506578 13:76294782-76294804 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1111230760 13:85341409-85341431 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1111418514 13:87977443-87977465 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1111560026 13:89932679-89932701 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1112052093 13:95653128-95653150 GGCTAGAGAAGCTGGAACGTGGG - Intergenic
1112056329 13:95691958-95691980 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1112077428 13:95929097-95929119 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1113193841 13:107782146-107782168 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1113328973 13:109310990-109311012 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1113735901 13:112678942-112678964 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1113877828 13:113605783-113605805 GGGAGGAGAAGGTGGCACGGTGG + Intronic
1114137106 14:19865803-19865825 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114165020 14:20212152-20212174 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114174630 14:20309435-20309457 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114198944 14:20505406-20505428 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114280357 14:21188309-21188331 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114336544 14:21697382-21697404 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114427513 14:22636503-22636525 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114480250 14:23029249-23029271 GGCAAGAGAGCATGGCACTGGGG - Intronic
1114507743 14:23231732-23231754 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1114578609 14:23736422-23736444 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1114594462 14:23899107-23899129 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1115259611 14:31438077-31438099 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1115539986 14:34411396-34411418 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1115622475 14:35153293-35153315 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1115689104 14:35825486-35825508 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1115703901 14:35978536-35978558 GGCAGGAGAAACAGGCAGGGAGG + Intergenic
1115847826 14:37556440-37556462 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1116005512 14:39286348-39286370 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1116192202 14:41675506-41675528 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1116840958 14:49820710-49820732 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1116959776 14:50957135-50957157 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1117010773 14:51468194-51468216 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1117033780 14:51705442-51705464 GGGAAGAGAAACAGACAGGGTGG - Intronic
1117276848 14:54202711-54202733 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1117596725 14:57333182-57333204 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1118148442 14:63164928-63164950 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1118184007 14:63522036-63522058 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1118209496 14:63751961-63751983 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1118239149 14:64038746-64038768 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1118253419 14:64183819-64183841 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1118341406 14:64896584-64896606 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1118423396 14:65633111-65633133 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1118428774 14:65693410-65693432 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1118517886 14:66546675-66546697 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1118584549 14:67340766-67340788 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1118890206 14:69902709-69902731 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1118955452 14:70477058-70477080 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1119051982 14:71377879-71377901 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1119559412 14:75578497-75578519 GGCAAGAGACACTGGGTCGGGGG + Intergenic
1119595146 14:75925953-75925975 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1119698775 14:76735378-76735400 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1119700155 14:76749720-76749742 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1119722176 14:76898771-76898793 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1119835587 14:77747009-77747031 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1119868670 14:77994430-77994452 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1119890232 14:78176993-78177015 GGGAGGAGAAACTGGAATGGAGG + Intergenic
1120086941 14:80286090-80286112 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1120170690 14:81245152-81245174 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1120193897 14:81463042-81463064 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1120892722 14:89505367-89505389 GGCAGGAGAAACAGGCAGGGAGG - Intronic
1121143057 14:91558250-91558272 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1121435341 14:93915464-93915486 GGCAAGAGAAACTGAGACAGGGG + Intergenic
1121531435 14:94657516-94657538 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1121912873 14:97807916-97807938 TGGAAGAGAGACTGGCACAGAGG - Intergenic
1122425548 14:101603285-101603307 GGCAAGGGAACCAGGCACAGGGG - Intergenic
1122568697 14:102678106-102678128 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1122957911 14:105079943-105079965 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1202847975 14_GL000009v2_random:199521-199543 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1202917458 14_GL000194v1_random:190074-190096 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1124245654 15:28069505-28069527 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1124335232 15:28850544-28850566 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1125566398 15:40682189-40682211 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1125651306 15:41320370-41320392 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1125861399 15:43004471-43004493 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1126125870 15:45293854-45293876 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1126210856 15:46098703-46098725 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1126295215 15:47131842-47131864 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1126387443 15:48108745-48108767 AGCAAGAGAAACATGAACGGGGG - Intergenic
1126517354 15:49551185-49551207 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1126571478 15:50157847-50157869 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1126573034 15:50172235-50172257 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1126691680 15:51293649-51293671 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1126752073 15:51886569-51886591 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1126799292 15:52285576-52285598 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1126816674 15:52460549-52460571 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1127023966 15:54781998-54782020 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1127153940 15:56109138-56109160 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1127382295 15:58440580-58440602 GGCTAGAGACCCTGGCACAGTGG - Intronic
1127584100 15:60365941-60365963 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1127783123 15:62333194-62333216 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1127824499 15:62690917-62690939 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1127874156 15:63098367-63098389 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1128071513 15:64799948-64799970 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1128151547 15:65366464-65366486 GGCAGGAGAAACTAGGACTGAGG + Intronic
1128490406 15:68136496-68136518 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1128587328 15:68860997-68861019 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1128597629 15:68965419-68965441 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1128843868 15:70872298-70872320 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1129008586 15:72395947-72395969 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1129054303 15:72807972-72807994 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1129313620 15:74728364-74728386 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1129438098 15:75558621-75558643 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1130340998 15:82999063-82999085 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1130522266 15:84672359-84672381 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1130882740 15:88069206-88069228 GGCAAGAGGAACTTGCCCAGAGG - Intronic
1130942539 15:88523532-88523554 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1130946887 15:88554371-88554393 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1131001576 15:88942603-88942625 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1131044026 15:89297654-89297676 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1131127010 15:89867115-89867137 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1131141062 15:89977582-89977604 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1131479530 15:92769223-92769245 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1132300920 15:100774899-100774921 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1132921977 16:2400666-2400688 GGCAGGAGAACCAGGCAGGGAGG + Intergenic
1132992409 16:2802774-2802796 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1133365196 16:5203646-5203668 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1133680263 16:8114506-8114528 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1133752248 16:8733724-8733746 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1133786991 16:8981568-8981590 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1134082927 16:11336606-11336628 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1134398680 16:13889165-13889187 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1134471973 16:14533309-14533331 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1134750292 16:16619744-16619766 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1134854451 16:17506713-17506735 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1134995165 16:18733854-18733876 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1135295737 16:21278034-21278056 GGCAGGAGAAACTGGAAAGCGGG - Intronic
1135343122 16:21665582-21665604 GGAAAGAGTAAATGGCAGGGAGG + Intergenic
1135575481 16:23582909-23582931 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1136130627 16:28218556-28218578 GACAAGGGAACCGGGCACGGTGG + Intergenic
1136160395 16:28415949-28415971 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1136202700 16:28699365-28699387 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1136232206 16:28893250-28893272 AGCAAGAGAGACAGGCATGGTGG + Intronic
1136571972 16:31103723-31103745 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1136596481 16:31253694-31253716 AGCAAGAGAAACTGAGAAGGAGG + Intergenic
1136919189 16:34246770-34246792 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1137240946 16:46654027-46654049 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1137283709 16:46999550-46999572 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1137430947 16:48417406-48417428 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1137439198 16:48483749-48483771 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1137523172 16:49211106-49211128 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1137686384 16:50389963-50389985 GGCCAGAGATACTGGCATGCTGG - Intergenic
1138028073 16:53538669-53538691 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1138037605 16:53624858-53624880 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1138043235 16:53697454-53697476 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1138400731 16:56740918-56740940 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1138418939 16:56886826-56886848 GGCAAAAGAAAAGGGCACCGTGG + Intronic
1138642740 16:58397710-58397732 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1138699483 16:58846951-58846973 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1139378233 16:66514212-66514234 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1139394609 16:66630431-66630453 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1139452468 16:67041631-67041653 GGCTAGAGAAACTGGGACTATGG + Intronic
1139556178 16:67712378-67712400 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1139623372 16:68164294-68164316 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1139864034 16:70050419-70050441 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1139885285 16:70203965-70203987 GGCAGGAGAATCAGGCACGGAGG - Intergenic
1139888115 16:70225360-70225382 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1140063148 16:71588931-71588953 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1140883024 16:79215962-79215984 GGCAAGAGAAAATGGCCCATGGG - Intergenic
1141728884 16:85808878-85808900 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1142011658 16:87718462-87718484 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1142407686 16:89900186-89900208 GGCAAGAGAAACTGGCACGGTGG + Intronic
1142529710 17:571635-571657 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1142634408 17:1247798-1247820 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1142657553 17:1403923-1403945 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1142683670 17:1564345-1564367 GGCAAGACAGGCTGGCATGGGGG + Intergenic
1142818408 17:2446702-2446724 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1142825182 17:2506378-2506400 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1142913352 17:3113509-3113531 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1142940047 17:3372727-3372749 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1142949056 17:3464073-3464095 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1142963349 17:3564910-3564932 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1143008682 17:3853743-3853765 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1143115392 17:4578929-4578951 GGCAGGAGAACCAGGCAGGGAGG + Intergenic
1143277354 17:5721804-5721826 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1143342643 17:6225757-6225779 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1143593996 17:7903242-7903264 GGCAAGAGAAAGTGGCGGGTGGG - Intronic
1143667551 17:8373267-8373289 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1143884653 17:10056882-10056904 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1143898474 17:10155611-10155633 GGGAAGAGAAAATGGGAGGGAGG - Intronic
1144509871 17:15866877-15866899 GGCAGGAGAATCCGGCAGGGAGG - Intergenic
1144536220 17:16094657-16094679 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1144541197 17:16145002-16145024 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1144799141 17:17913090-17913112 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1144866231 17:18337664-18337686 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1145022119 17:19440912-19440934 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145047447 17:19628786-19628808 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1145086898 17:19950402-19950424 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1145158264 17:20557047-20557069 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145173975 17:20684496-20684518 GGCAGGAGAATCTGGCAGGGAGG - Intergenic
1145231113 17:21173956-21173978 GGGAACAGAAAATGTCACGGAGG + Intronic
1145417960 17:22740601-22740623 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145717035 17:27033224-27033246 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145733492 17:27211483-27211505 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145862658 17:28223169-28223191 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1145895986 17:28458275-28458297 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1146049025 17:29533744-29533766 GGCAGGAGAATCAGGCAAGGAGG + Intronic
1146155742 17:30522908-30522930 GGCAGGAGAATCAGGCAGGGAGG - Exonic
1146216581 17:30981263-30981285 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1146444662 17:32923724-32923746 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1146731444 17:35195906-35195928 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1147172458 17:38630323-38630345 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1147277744 17:39333238-39333260 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1147278269 17:39337078-39337100 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1147622190 17:41875534-41875556 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1147708896 17:42448585-42448607 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1147741090 17:42671295-42671317 GGCGTGAGAAGCTGGCAGGGTGG + Intronic
1147784908 17:42972425-42972447 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1147974019 17:44237509-44237531 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1148016168 17:44524117-44524139 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1148059452 17:44825393-44825415 GGCAAGAGAATCTTGCCCAGGGG + Intronic
1148269739 17:46253652-46253674 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1148404108 17:47397104-47397126 GGCAGGAGAATCAGGCAAGGAGG - Intronic
1148406304 17:47420040-47420062 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1149625261 17:58075116-58075138 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1149632875 17:58141921-58141943 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1149780802 17:59394992-59395014 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1149793468 17:59499546-59499568 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1150380482 17:64716115-64716137 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1150427694 17:65089533-65089555 GGCAAGAGATACTGGTAGGGTGG + Intergenic
1150477096 17:65483914-65483936 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1150518154 17:65836895-65836917 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1150527191 17:65936908-65936930 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1150780426 17:68116883-68116905 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1150894776 17:69196917-69196939 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1152019951 17:77775757-77775779 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1152415592 17:80159649-80159671 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1152479066 17:80537932-80537954 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1152672542 17:81617751-81617773 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1153007797 18:512924-512946 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1153221884 18:2868699-2868721 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1153605619 18:6828254-6828276 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1153646962 18:7204137-7204159 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1154089481 18:11344138-11344160 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1154264999 18:12873380-12873402 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1154290103 18:13099083-13099105 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1154398490 18:14011754-14011776 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1154990443 18:21593493-21593515 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1155521512 18:26673407-26673429 GGGAAGAGGGTCTGGCACGGTGG - Intergenic
1155956301 18:31959622-31959644 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1156066482 18:33148327-33148349 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1156326499 18:36078554-36078576 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1157455750 18:47827573-47827595 GGCAGGAGAATCAGGCAGGGAGG - Exonic
1157629635 18:49081407-49081429 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1157677602 18:49578915-49578937 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1157705036 18:49799307-49799329 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1157857871 18:51117984-51118006 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1158148396 18:54342564-54342586 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1158459497 18:57633775-57633797 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1158646755 18:59255071-59255093 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1159055545 18:63459646-63459668 GGCAAGTGAAGCAGGCATGGGGG + Intergenic
1159247640 18:65830068-65830090 GACAAGAGAAAGTGGCACAGAGG + Intronic
1159422150 18:68235062-68235084 GGCAAGTGAAACAGGGAAGGAGG + Intergenic
1159615018 18:70570246-70570268 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1160182066 18:76645023-76645045 GGCAGGAGAATCAGGCAGGGGGG - Intergenic
1160228553 18:77029314-77029336 GGCAGGAGAATCAGGCAGGGGGG + Intronic
1160465626 18:79073531-79073553 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1161685618 19:5701423-5701445 GGCAGGAGAACCAGGCAGGGAGG - Intronic
1161790066 19:6354915-6354937 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1162163724 19:8738871-8738893 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1162254966 19:9482755-9482777 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1162278819 19:9679433-9679455 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1162361850 19:10225162-10225184 GGCCAGAGAGACTGGCTCTGCGG + Intronic
1162513082 19:11131521-11131543 GATAAGAGAAACAGGCCCGGGGG + Exonic
1162538336 19:11277391-11277413 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1162694926 19:12467230-12467252 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1162837273 19:13328921-13328943 GGCAAGAGAAAGAGGAAGGGAGG - Intronic
1163142893 19:15362450-15362472 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1163865399 19:19769586-19769608 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1163896616 19:20065152-20065174 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1163904177 19:20137370-20137392 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1163909571 19:20176728-20176750 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1163912967 19:20213989-20214011 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1163921626 19:20295865-20295887 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1163945654 19:20531131-20531153 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1163986246 19:20953329-20953351 GGCAGGAGAATCAGGCAAGGAGG + Intergenic
1164012292 19:21213343-21213365 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164040348 19:21487641-21487663 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1164043344 19:21511980-21512002 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1164064891 19:21707444-21707466 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1164066284 19:21720441-21720463 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1164071682 19:21775286-21775308 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1164081982 19:21866760-21866782 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164106267 19:22108612-22108634 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164126391 19:22322299-22322321 GGCAGGAGAATCAGGCAGGGTGG + Intergenic
1164168268 19:22701192-22701214 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164186349 19:22872302-22872324 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164217418 19:23161709-23161731 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1164218511 19:23172659-23172681 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1164244533 19:23418747-23418769 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1164256784 19:23534235-23534257 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1164263782 19:23594251-23594273 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1164659462 19:29949813-29949835 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1165193244 19:34080485-34080507 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1165199225 19:34131964-34131986 GGCAAGAGAATCAGGCAGGGAGG - Intergenic
1165295578 19:34922915-34922937 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1165482049 19:36069901-36069923 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1165540675 19:36490559-36490581 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1165727870 19:38124905-38124927 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1165842804 19:38798715-38798737 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1165852327 19:38856586-38856608 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1166028791 19:40109609-40109631 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1166029607 19:40117282-40117304 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1166115207 19:40649068-40649090 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1166163256 19:40967344-40967366 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1166418186 19:42611174-42611196 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1166421623 19:42640441-42640463 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1166640068 19:44488357-44488379 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1166832590 19:45647645-45647667 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1167298127 19:48663739-48663761 GGTAAGACAGTCTGGCACGGAGG - Exonic
1167427814 19:49438453-49438475 GGCGAGGGAGACTGGGACGGGGG + Intronic
1167540735 19:50085847-50085869 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1167547957 19:50140524-50140546 GGCACGAGAATCAGGCAGGGAGG - Intergenic
1167588859 19:50391600-50391622 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1167897660 19:52594221-52594243 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1167907690 19:52676073-52676095 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1167913413 19:52721582-52721604 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1167924353 19:52810982-52811004 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1167937293 19:52919260-52919282 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1167971212 19:53188485-53188507 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1167975357 19:53222362-53222384 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1167980410 19:53270573-53270595 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1168572470 19:57482671-57482693 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1168696390 19:58406250-58406272 GGCAAGAGAATCAGGCAGGGAGG + Intronic
924970807 2:126297-126319 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
925400646 2:3569896-3569918 GGCAGGAGAATCAGGCAGGGGGG + Intergenic
925403787 2:3592151-3592173 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
925407736 2:3616662-3616684 GGCAGGAGAACCAGGCAGGGAGG + Intronic
925651387 2:6093302-6093324 GGCAAGAGGATCAGGCATGGGGG - Intergenic
926252920 2:11165919-11165941 GGCAGGAGAATCAGGCAGGGAGG + Intronic
926322816 2:11760584-11760606 GGCAGGAGAATCAGGCAGGGAGG + Intronic
926683498 2:15680939-15680961 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
927747076 2:25633256-25633278 GGCAGGAGAATCAGGCAGGGAGG - Intronic
927755491 2:25705177-25705199 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
927758003 2:25724066-25724088 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
927777200 2:25911510-25911532 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
927978572 2:27358858-27358880 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
927983581 2:27391624-27391646 AGCAAGAGAAACTATCAAGGGGG - Intronic
928005600 2:27558804-27558826 GGCAGGAGAATCAGGCAGGGAGG + Intronic
928320943 2:30282408-30282430 GGAAAGAGAAACTGGGCCTGAGG - Intronic
928542354 2:32294970-32294992 GGCAGGAGAATCAGGCAGGGAGG + Intronic
928558270 2:32448554-32448576 GGCAGGAGAATCAGGCAGGGAGG + Intronic
928585671 2:32755486-32755508 GGCAGGAGAATCAGGCAGGGAGG + Intronic
928687326 2:33762094-33762116 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
928722311 2:34133825-34133847 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
928888663 2:36179407-36179429 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
929062188 2:37933675-37933697 GGCAGGAGAATCAGGCAGGGAGG + Intronic
929066250 2:37978223-37978245 GGCAGGAGAATCAGGCAGGGAGG + Intronic
929152070 2:38756608-38756630 GGCAGGAGAATCAGGCAGGGAGG + Intronic
929238479 2:39629093-39629115 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
929341604 2:40825587-40825609 AGAAAGAGACACTGGCACTGTGG - Intergenic
929415836 2:41746181-41746203 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
929445079 2:41995140-41995162 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
929448044 2:42015510-42015532 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
929516427 2:42606972-42606994 GGCAGGAGAATCAGGCAGGGAGG + Intronic
929577923 2:43063911-43063933 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
929650950 2:43678613-43678635 GGCAGGAGAATCAGGCAGGGAGG + Intronic
929690459 2:44068237-44068259 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
929739370 2:44587568-44587590 GGCAGGAGAATCAGGCAGGGAGG - Intronic
930079533 2:47434429-47434451 GGCAGGAGAATCAGGCAGGGAGG + Intronic
930208986 2:48615376-48615398 GGCAGGAGAATCAGGCAGGGAGG + Intronic
930363480 2:50411119-50411141 GGCAGGAGAATCAGGCAGGGAGG - Intronic
930665735 2:54096736-54096758 GGCAGGAGAATCAGGCAGGGAGG + Intronic
930688210 2:54331340-54331362 GGCAAGAGAAGCTGGTACTTGGG - Intronic
930703802 2:54485283-54485305 GGCAGGAGAATCAGGCAGGGAGG - Intronic
930727732 2:54698490-54698512 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
930834114 2:55774634-55774656 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
931479789 2:62629788-62629810 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
931584095 2:63808434-63808456 GGCAGGAGAATCAGGCAGGGAGG - Intronic
931604896 2:64042365-64042387 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
931656469 2:64513112-64513134 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
931751922 2:65338390-65338412 GGCAGGAGAATCAGGCAGGGAGG - Intronic
931783874 2:65601745-65601767 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
932367107 2:71160546-71160568 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
932410419 2:71543765-71543787 GGCAGGAGAATCAGGCACGGAGG + Intronic
932807691 2:74796934-74796956 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
932903328 2:75724686-75724708 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
933830099 2:86199781-86199803 AGCCAGAGAAACTGGAACGGAGG + Intronic
934128218 2:88920011-88920033 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
934548934 2:95242942-95242964 GGCAGGAGAATCAGGCAGGGAGG - Intronic
934703291 2:96460894-96460916 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
934998684 2:98989594-98989616 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
935630981 2:105211819-105211841 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
935636062 2:105250746-105250768 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
936158355 2:110064545-110064567 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
936186306 2:110306781-110306803 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
936345473 2:111672169-111672191 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
937168916 2:119845145-119845167 GGCAGGAGAATCAGGCAGGGAGG + Intronic
937437443 2:121892169-121892191 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
937735003 2:125277686-125277708 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
937940187 2:127279126-127279148 GGGAAGAGAAACTGGCCTGGAGG + Intronic
937947334 2:127352791-127352813 GGCAGGAGAATCAGGCAGGGAGG - Intronic
937951434 2:127390861-127390883 GGCAACTGAAACTTGAACGGGGG + Intergenic
938006334 2:127789594-127789616 GGCAGGAGAATCAGGCAGGGAGG + Intronic
938068115 2:128292712-128292734 GGCCAGGGCAAATGGCACGGGGG + Intronic
938253283 2:129833113-129833135 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
938533640 2:132220456-132220478 GGCAGGAGAATCAGGCAGGGAGG - Intronic
938749236 2:134312961-134312983 GGCAGGAGAAGTTGGTACGGCGG - Intronic
938822108 2:134969255-134969277 GGCAGGAGAATCAGGCAGGGAGG + Intronic
938829272 2:135034702-135034724 GGCAGGAGAATCAGGCAGGGAGG + Intronic
938836077 2:135105324-135105346 GGCAGGAGAATCAGGCAGGGAGG - Intronic
939477134 2:142702010-142702032 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
940643105 2:156367653-156367675 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
940652564 2:156452446-156452468 GGCAGGAGAATCAGGCAGGGAGG + Intronic
941024149 2:160439958-160439980 GGCAGGAGAATCAGGCAGGGAGG + Intronic
941768573 2:169326308-169326330 GGCAGGAGAATCAGGCAGGGAGG - Intronic
941786474 2:169505047-169505069 GGCAGGAGAATCAGGCAGGGAGG - Exonic
941793482 2:169576021-169576043 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
941814971 2:169787264-169787286 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
941822510 2:169856735-169856757 GGCAGGAGAATCAGGCAGGGAGG + Intronic
941847610 2:170149130-170149152 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
942012056 2:171774162-171774184 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
942021176 2:171867525-171867547 GGCAGGAGAATCAGGCAGGGAGG + Intronic
942024531 2:171899331-171899353 GGCAGGAGAATCAGGCAGGGAGG - Intronic
942096019 2:172537285-172537307 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
942113036 2:172700906-172700928 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
942355500 2:175107658-175107680 GGCAGGAGAATCAGGCAGGGAGG - Intronic
942629973 2:177944923-177944945 GGCAGGAGAATCAGGCAGGGAGG - Intronic
943100189 2:183478642-183478664 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
943297343 2:186154902-186154924 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
943323291 2:186472341-186472363 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
943411568 2:187555994-187556016 GGCAGGAGAATCAGGCAGGGAGG - Intronic
943740176 2:191399169-191399191 GGCAGGAGAATCAGGCAGGGAGG + Intronic
943773224 2:191741309-191741331 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
943863064 2:192893573-192893595 GGCAGGAGAAGCAGGCAGGGAGG - Intergenic
944060546 2:195567286-195567308 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
944255176 2:197618178-197618200 GGCAGGAGAATCAGGCAGGGAGG - Intronic
944263303 2:197697315-197697337 GGCAGGAGAATCAGGCAGGGAGG + Intronic
944283717 2:197924050-197924072 GGCAGGAGAATCAGGCAGGGAGG + Intronic
944533203 2:200684635-200684657 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
944570701 2:201042049-201042071 GGCAGGAGAATCAGGCAGGGAGG - Intronic
944599030 2:201284580-201284602 GGCAGGAGAATCAGGCAGGGAGG + Intronic
944672585 2:202007405-202007427 TGCCAGGGAAACTGGCATGGTGG + Intergenic
944733220 2:202535977-202535999 GGCAGGAGAATCAGGCAGGGAGG + Intronic
944751734 2:202715985-202716007 GGCAGGAGAATCAGGCAGGGAGG + Intronic
944797795 2:203206508-203206530 GGCAGGAGAATCAGGCAGGGAGG - Intronic
944815735 2:203373366-203373388 GGCAGGAGAATCAGGCAGGGAGG + Intronic
945090526 2:206172502-206172524 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
945110809 2:206357658-206357680 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
945232793 2:207609890-207609912 GGCAGGAGAATCAGGCAGGGAGG - Exonic
945316809 2:208378276-208378298 GGCAGGAGAATCAGGCAGGGAGG + Intronic
945530663 2:210950233-210950255 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
945835972 2:214836258-214836280 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
945864984 2:215164176-215164198 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
945970597 2:216227459-216227481 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
946317983 2:218930891-218930913 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
946447499 2:219751902-219751924 GGCAAGAGAATCAGGCAGGGAGG + Intergenic
947402192 2:229742271-229742293 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
947901552 2:233725090-233725112 GGCAGGAGAATCAGGCAGGGAGG + Intronic
948000298 2:234562258-234562280 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
948651808 2:239450281-239450303 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1169085508 20:2823158-2823180 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1169109009 20:3019977-3019999 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1169246736 20:4031941-4031963 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1169370673 20:5026988-5027010 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1169441917 20:5639904-5639926 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1169718130 20:8643887-8643909 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1169734775 20:8825803-8825825 GGCAAGAGACTCTGGCAGTGTGG + Intronic
1169853065 20:10074419-10074441 GTCCAGAGAAACTGGAAGGGAGG + Intergenic
1169885777 20:10395682-10395704 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1169992055 20:11514093-11514115 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1170645557 20:18193998-18194020 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1170664683 20:18376197-18376219 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1170811778 20:19679406-19679428 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1170955059 20:20972383-20972405 GGAAAGACAAGCTGGCACCGGGG - Intergenic
1171081563 20:22191287-22191309 GGCAAAAGAAACTGTCAAGGAGG + Intergenic
1171357518 20:24560669-24560691 GTCAACAGAAACTGTCTCGGGGG - Intronic
1171366289 20:24626979-24627001 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1171463521 20:25312271-25312293 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1171496670 20:25561129-25561151 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1171837415 20:30169342-30169364 GGCAAGAGAATATGAGACGGAGG - Intergenic
1171848634 20:30292555-30292577 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1171861087 20:30404310-30404332 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1171951475 20:31426392-31426414 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172051781 20:32123072-32123094 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1172058894 20:32175435-32175457 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172109206 20:32535771-32535793 GGGAAGAGAAAGGGGCACAGTGG + Intronic
1172141016 20:32723237-32723259 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1172199461 20:33115055-33115077 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172209370 20:33186098-33186120 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1172237567 20:33388717-33388739 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1172279147 20:33698581-33698603 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172337748 20:34131937-34131959 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172348391 20:34222731-34222753 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1172379402 20:34475558-34475580 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1172401796 20:34658085-34658107 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1172465390 20:35152966-35152988 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172575201 20:36002300-36002322 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1172720821 20:36999584-36999606 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1172735669 20:37125312-37125334 GGCAGGAGAACCAGGCAGGGAGG - Intronic
1172907084 20:38378261-38378283 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1172918727 20:38462444-38462466 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1173273323 20:41556155-41556177 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1173461491 20:43246770-43246792 GGTAAGACAGACTGGGACGGAGG - Intergenic
1173473148 20:43338932-43338954 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1173769746 20:45646681-45646703 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1174020803 20:47526664-47526686 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1174344706 20:49921542-49921564 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1174835685 20:53853908-53853930 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1175776068 20:61654328-61654350 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1176217331 20:63954428-63954450 GGCAGGAGGCACTGGAACGGTGG + Intronic
1176348583 21:5771704-5771726 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1176355397 21:5892288-5892310 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1176496244 21:7552751-7552773 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1176542904 21:8169774-8169796 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1176561855 21:8352819-8352841 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1176656832 21:9594427-9594449 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1177134351 21:17292986-17293008 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1177788445 21:25696291-25696313 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1178034236 21:28563302-28563324 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1178075362 21:29010760-29010782 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1178807135 21:35848598-35848620 AGAAAAAGAAACGGGCACGGTGG - Intronic
1178873266 21:36393115-36393137 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1179195057 21:39156721-39156743 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1179803195 21:43821679-43821701 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1179814738 21:43898034-43898056 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1179969011 21:44824174-44824196 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1180039334 21:45268086-45268108 GGCAGGAGAACCAGGCAGGGAGG - Intronic
1180124938 21:45784553-45784575 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1180671961 22:17560722-17560744 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1180739427 22:18042261-18042283 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1180861135 22:19083811-19083833 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1181296829 22:21847092-21847114 GGCAGGAGAAACAGGCAGGAAGG - Intronic
1181301686 22:21884684-21884706 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1181585956 22:23853907-23853929 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1181598740 22:23936533-23936555 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1181617704 22:24065907-24065929 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1181658172 22:24318424-24318446 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1181792466 22:25278525-25278547 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1182343786 22:29644824-29644846 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1182377549 22:29858870-29858892 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1182538732 22:31026382-31026404 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1182564161 22:31184818-31184840 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1182616999 22:31593888-31593910 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1182976459 22:34626880-34626902 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1183434602 22:37786319-37786341 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1183537337 22:38410600-38410622 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1183595058 22:38806398-38806420 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1183596721 22:38817174-38817196 GGCAGGAGAAACTTGAACGTGGG + Intergenic
1183871880 22:40746298-40746320 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1183940790 22:41294144-41294166 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1183995892 22:41632031-41632053 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1184145345 22:42607204-42607226 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1184169598 22:42751150-42751172 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1184201208 22:42971178-42971200 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1184202464 22:42980579-42980601 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1184766672 22:46576110-46576132 GGCAAGAGACACAGGAAGGGCGG + Intronic
1203247771 22_KI270733v1_random:86017-86039 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
949330572 3:2917204-2917226 GGCAGGAGAATCAGGCAGGGAGG + Intronic
949551302 3:5114558-5114580 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
949570144 3:5284627-5284649 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
949853178 3:8439144-8439166 GGCAAGAGAATCAGGCAGGGAGG - Intergenic
949988606 3:9559489-9559511 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
949989771 3:9569573-9569595 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
949992514 3:9591389-9591411 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
950044405 3:9940571-9940593 GGCAGGAGAATCAGGCAGGGAGG + Intronic
950060672 3:10069554-10069576 GGCAGGAGAATCAGGCAGGGAGG - Intronic
950412872 3:12850425-12850447 GGCAGGAGAATCAGGCAGGGAGG + Intronic
950742243 3:15061308-15061330 GGCAGGAGAATCAGGCAGGGAGG - Intronic
950755062 3:15164044-15164066 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
950819364 3:15741829-15741851 GGCAGGAGAATCAGGCAGGGAGG - Intronic
950949316 3:16981039-16981061 GGCAAGAGAATCAGGCAGGGAGG + Intronic
951264363 3:20548671-20548693 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
951290635 3:20867693-20867715 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
951550681 3:23872276-23872298 GGCAGGAGAATCAGGCAGGGAGG + Intronic
951906711 3:27714121-27714143 GGGAGGAGATACTGGCTCGGGGG - Intergenic
952308729 3:32169183-32169205 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
952364555 3:32663567-32663589 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
952892481 3:38052882-38052904 GGCAGGAGAATCAGGCAGGGAGG - Intronic
952894140 3:38065241-38065263 GGCAGGAGAATCAGGCAGGGAGG + Intronic
953037637 3:39227154-39227176 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
953084281 3:39651880-39651902 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
953084737 3:39655385-39655407 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
953425844 3:42797051-42797073 GGCAGGAGAATCAGGCAGGGAGG - Intronic
953652912 3:44822027-44822049 GGCAGGAGAATCAGGCAGGGAGG + Intronic
953854955 3:46494005-46494027 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
953922668 3:46963548-46963570 GGCAGGAGAATCAGGCAGGGAGG - Intronic
953959369 3:47255852-47255874 GGCAGGAGAATCAGGCAGGGAGG - Intronic
953966338 3:47309894-47309916 GGCAGGAGAATCAGGCAGGGAGG + Intronic
954059136 3:48055307-48055329 GGCAGGAGAATCAGGCAGGGAGG - Intronic
954162583 3:48733599-48733621 GGCAGGAGAATCAGGCAGGGAGG - Intronic
954356421 3:50085751-50085773 GGCAGGAGAATCAGGCAGGGAGG + Intronic
954399777 3:50312879-50312901 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
954529929 3:51309487-51309509 GGCAGGAGAATCAGGCAGGGAGG + Intronic
954567217 3:51608729-51608751 GGCAGGAGAATCAGGCAGGGAGG + Intronic
954599634 3:51858083-51858105 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
954713791 3:52517293-52517315 GGGAAGAGACACTGGGATGGGGG - Intronic
955363257 3:58291281-58291303 GGCAGGAGAATCAGGCAGGGAGG + Intronic
955395069 3:58551024-58551046 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
955435090 3:58891317-58891339 GGCAGGAGAATCAGGCAGGGAGG + Intronic
955626699 3:60927092-60927114 GGCAGGAGAATCAGGCAGGGAGG - Intronic
955670213 3:61394289-61394311 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
955699959 3:61672622-61672644 GGCAGGAGAATCAGGCAGGGAGG + Intronic
956803708 3:72787807-72787829 GGCAGGAGAATCAGGCAGGGAGG - Intronic
957035297 3:75288801-75288823 GGCAGGAGAATCAGGCAGGGGGG - Intergenic
957316953 3:78584212-78584234 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
957517615 3:81276197-81276219 TGCAAGAGAAAGTAGCACAGTGG + Intergenic
957619981 3:82583961-82583983 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
958907389 3:99956816-99956838 TGGAAGAGAAACTGGCAGAGTGG - Intronic
959201861 3:103255804-103255826 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
959415909 3:106075692-106075714 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
959586183 3:108026788-108026810 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
959683623 3:109123465-109123487 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
960030266 3:113047444-113047466 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
960073498 3:113458305-113458327 GGCAGGAGAATCAGGCAGGGAGG - Intronic
960344750 3:116518726-116518748 GGCAGGAGAATCAGGCAGGGAGG - Intronic
960780786 3:121314498-121314520 GGCAGGAGAATCAGGCAGGGAGG + Intronic
960861853 3:122163795-122163817 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
960866225 3:122202321-122202343 GGCAGGAGAATCAGGCAGGGAGG + Intronic
960920842 3:122746745-122746767 GGCAGGAGAATCAGGCAGGGAGG - Intronic
960924579 3:122781458-122781480 GGCAGGAGAATCAGGCAGGGAGG + Intronic
961120921 3:124368953-124368975 GGCAGGAGAATCAGGCAGGGAGG + Intronic
961164051 3:124751251-124751273 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
961324555 3:126102561-126102583 AGCAAGAGAAACATGCATGGAGG + Intergenic
961729046 3:128953708-128953730 GGCAGGAGAATCAGGCAGGGAGG - Intronic
961784657 3:129340701-129340723 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
961789273 3:129364242-129364264 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
961962260 3:130867402-130867424 GGCAGGAGAATCAGGCAGGGAGG - Intronic
962063039 3:131951655-131951677 GGCAGGAGAATCAGGCAGGGAGG - Intronic
962113228 3:132472139-132472161 GGCAGGAGAATCAGGCAGGGAGG + Intronic
962572020 3:136722784-136722806 GGCAGGAGAATCAGGCAGGGAGG - Intronic
962623212 3:137199183-137199205 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
962688689 3:137872243-137872265 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
962761677 3:138520901-138520923 GGCAGGAGAATCAGGCAGGGAGG - Intronic
962787802 3:138784522-138784544 GGCAGGAGAATCAGGCAGGGAGG - Intronic
963249243 3:143087491-143087513 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
963498228 3:146095979-146096001 GGCAGGAGAATCAGGCAGGGAGG - Intronic
963776531 3:149445647-149445669 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
963911771 3:150821740-150821762 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
964584306 3:158279769-158279791 GGAAAGAGGAAGTGGCATGGGGG - Intronic
965136813 3:164784026-164784048 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
965302197 3:167018197-167018219 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
965649917 3:170923093-170923115 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
966050054 3:175604894-175604916 GGCAAGAGAGATTGGCAGTGAGG + Intronic
966206825 3:177413559-177413581 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
966253608 3:177892482-177892504 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
966350855 3:179032095-179032117 GGCAGGAGAATCAGGCAGGGAGG - Intronic
966617354 3:181926572-181926594 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
966783694 3:183607431-183607453 GGCAGGAGAATCAGGCATGGAGG - Intergenic
966967079 3:185004383-185004405 GGCAGGAGAACCAGGCAGGGAGG + Intronic
967127387 3:186436104-186436126 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
967169534 3:186812334-186812356 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
967175941 3:186863632-186863654 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
967177347 3:186873351-186873373 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
967178820 3:186885455-186885477 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
967524117 3:190472794-190472816 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
967578660 3:191125686-191125708 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
968139300 3:196243626-196243648 GGCAGGAGAATCAGGCAGGGAGG - Intronic
968156407 3:196385095-196385117 GGCAGGAGAATCAGGCAGGGAGG - Intronic
968299692 3:197603097-197603119 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
968411501 4:395082-395104 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
968430011 4:551315-551337 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
968507002 4:975435-975457 GGCAGGAGAATCAGGCAGGGAGG - Intronic
968924455 4:3539612-3539634 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
969384906 4:6837817-6837839 GGCAGGAGAATCAGGCAGGGAGG + Intronic
969404018 4:6977213-6977235 GGCAGGAGAATCAGGCAGGGAGG - Intronic
969508495 4:7603062-7603084 GGCAGGAGAATCAGGCAGGGAGG + Intronic
970409082 4:15790275-15790297 GGCAGGAGAATCAGGCAGGGAGG - Intronic
970472893 4:16394204-16394226 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
970481241 4:16477874-16477896 TGCAGTAGAAACTGGCACTGTGG - Intergenic
971594996 4:28515681-28515703 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
972288126 4:37668308-37668330 GGCAGGAGAATCAGGCAGGGAGG - Intronic
972304590 4:37819923-37819945 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
972505177 4:39714295-39714317 GGCAAGAGAAACTGGATGGCAGG - Intronic
972551933 4:40141991-40142013 GGCAGGAGAATCAGGCAGGGAGG + Intronic
972552788 4:40148354-40148376 GGCAGGAGAATCAGGCAGGGAGG + Intronic
972653999 4:41048765-41048787 GGCAGGAGAATCAGGCAGGGAGG - Intronic
972938326 4:44167435-44167457 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
972939593 4:44181338-44181360 GGCAGGAGAACCAGGCAGGGAGG - Intronic
973263219 4:48185950-48185972 GGCAGGAGAATCTGGCAGGGAGG - Intronic
973274237 4:48291860-48291882 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
973281668 4:48364768-48364790 GGCAGGAGAATCAGGCAGGGAGG + Intronic
973593260 4:52464207-52464229 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
973650291 4:52992119-52992141 GGCAGGAGAATCAGGCAGGGAGG - Intronic
973663974 4:53138963-53138985 GGCAGGAGAATCAGGCAGGGAGG - Intronic
973675376 4:53256768-53256790 GGCAGGAGAATCAGGCAGGGGGG + Intronic
973752186 4:54032358-54032380 GGCAGGAGAATCAGGCAGGGAGG - Intronic
973785212 4:54326414-54326436 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
974021366 4:56694191-56694213 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
974076449 4:57172630-57172652 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
974082031 4:57223893-57223915 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
974597725 4:64036738-64036760 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
974870412 4:67636484-67636506 GGCAGGAGAATCAGGCAGGGAGG - Intronic
975042308 4:69761453-69761475 GGCAGGAGAATCAGGCAGGGAGG - Intronic
975633309 4:76422830-76422852 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
975685429 4:76916172-76916194 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
975793848 4:77984667-77984689 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
975796066 4:78007788-78007810 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
975848223 4:78547431-78547453 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
975908634 4:79244720-79244742 GGCAGGAGAATCAGGCAGGGAGG - Intronic
976264923 4:83181569-83181591 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
976266148 4:83186898-83186920 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
976341019 4:83944565-83944587 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
976349680 4:84046906-84046928 GGCATGAAACACTGGCACTGGGG + Intergenic
976607263 4:86995404-86995426 GGCAGGAGAATCAGGCAGGGAGG - Intronic
977542298 4:98331199-98331221 GGCAGGAGAATCAGGCAGGGAGG + Intronic
978224767 4:106320839-106320861 GGCAGGAGAATCAGGCAGGGAGG - Intronic
978408977 4:108408912-108408934 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
978519202 4:109598499-109598521 GGCAGGAGAATCAGGCAGGGAGG + Intronic
978519656 4:109603188-109603210 GGCAGGAGAATCAGGCAGGGAGG - Intronic
978820413 4:112958497-112958519 GGCAGGAGAATCAGGCAGGGAGG + Intronic
979273584 4:118791617-118791639 GGCAGGAGAATCAGGCAGGGAGG - Intronic
979482734 4:121238074-121238096 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
979622221 4:122811284-122811306 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
979641785 4:123017025-123017047 GGCAGGAGAATCAGGCAGGGAGG + Intronic
979702374 4:123684410-123684432 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
979941625 4:126770696-126770718 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
980056677 4:128084528-128084550 GGCAGGAGAATCAGGCAGGGAGG + Intronic
980883545 4:138738888-138738910 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
981677321 4:147357368-147357390 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
981970265 4:150658840-150658862 GGCAGGAGAATCAGGCAGGGAGG - Intronic
981993541 4:150953457-150953479 GGCAGGAGAATCAGGCAGGGAGG - Intronic
981994687 4:150963278-150963300 GGCAGGAGAATCAGGCAGGGAGG - Intronic
982020273 4:151196095-151196117 GGCAAGAGAAAGTAGGACAGAGG + Intronic
982040256 4:151390262-151390284 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
982053783 4:151527427-151527449 GGCAGGAGAATCAGGCAGGGAGG + Intronic
982067978 4:151671545-151671567 AGCCAGAGAAGCTGGCACGTGGG + Intronic
982075161 4:151731207-151731229 GGCAGGAGAATCAGGCAGGGAGG - Intronic
982183019 4:152766023-152766045 GGCAGGAGAATCAGGCAGGGAGG + Intronic
982192211 4:152867399-152867421 GGCAGGAGAATCAGGCAGGGAGG + Intronic
982709863 4:158747380-158747402 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
982821086 4:159940547-159940569 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
983218297 4:165020851-165020873 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
983604407 4:169569584-169569606 GGCAGGAGAATCAGGCAGGGAGG - Intronic
983613903 4:169679793-169679815 GGCAGGAGAATCAGGCAGGGAGG + Intronic
983628623 4:169827896-169827918 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
983652084 4:170045846-170045868 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
983664605 4:170166983-170167005 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
984037733 4:174691482-174691504 GGCAGGAGAATCAGGCAGGGAGG - Intronic
984596877 4:181679217-181679239 GGCTACAGAAACTGGCAGTGAGG - Intergenic
984728287 4:183041553-183041575 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
984804393 4:183737692-183737714 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
984813865 4:183819448-183819470 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
984977348 4:185241381-185241403 GGCAGGAGAATCAGGCAGGGAGG + Intronic
985216248 4:187657585-187657607 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
985247371 4:187991849-187991871 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
985736279 5:1585502-1585524 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
986060853 5:4188734-4188756 GGCAACAGAAACTTGCAGGCAGG + Intergenic
987069254 5:14320532-14320554 GCCAAGAGACACTTGCAAGGGGG - Intronic
987469140 5:18309076-18309098 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
988544179 5:32141694-32141716 GGCAGGAGAATCAGGCAGGGAGG - Intronic
988752561 5:34205074-34205096 GGCAAAAGAAACTTGTACGAAGG + Intergenic
988760836 5:34307602-34307624 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
989021659 5:37014110-37014132 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989048296 5:37295139-37295161 GGCAGGAGAATCAGGCAGGGAGG - Intronic
989061742 5:37416412-37416434 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989068306 5:37484458-37484480 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989076163 5:37564430-37564452 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989211711 5:38863067-38863089 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989252513 5:39333704-39333726 GGCAGGAGAATCAGGCAGGGAGG - Intronic
989574604 5:42978789-42978811 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
989574888 5:42979925-42979947 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
989588156 5:43089022-43089044 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989634704 5:43521593-43521615 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
989640615 5:43579052-43579074 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
989648919 5:43666495-43666517 GGCAGGAGAATCAGGCAGGGAGG + Intronic
989656079 5:43746992-43747014 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
989663614 5:43825267-43825289 GGCAAGAGAATCAGGCAGGGAGG + Intergenic
989828732 5:45890068-45890090 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
990293753 5:54380873-54380895 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
990297899 5:54421267-54421289 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
990459251 5:56015876-56015898 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
990462170 5:56039471-56039493 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
990485880 5:56258755-56258777 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
990501243 5:56398557-56398579 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
990871177 5:60431975-60431997 GGCAGGAGAATCAGGCAGGGAGG + Intronic
991073976 5:62514495-62514517 GGCAGGAGAATCAGGCAGGGAGG + Intronic
991127515 5:63084530-63084552 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
991373087 5:65939639-65939661 GGCAGGAGAATCAGGCAGGGAGG - Intronic
991375239 5:65958524-65958546 GGCAGGAGAATCAGGCAGGGAGG + Intronic
991598042 5:68324456-68324478 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
991672750 5:69063600-69063622 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
991723819 5:69516400-69516422 GGCAGGAGAATCAGGCAGGGAGG + Intronic
991728843 5:69562912-69562934 AGAGAGAGAAACGGGCACGGTGG - Intronic
991740328 5:69665888-69665910 GGCAAAAGAAACTTGTACGAAGG + Intergenic
991757170 5:69887279-69887301 GGCAAAAGAAACTTGTACGAAGG - Intergenic
991791903 5:70245629-70245651 GGCAAAAGAAACTTGTACGAAGG + Intergenic
991805272 5:70418061-70418083 AGAGAGAGAAACGGGCACGGTGG - Intergenic
991819791 5:70542005-70542027 GGCAAAAGAAACTTGTACGAAGG + Intergenic
991836573 5:70763161-70763183 GGCAAAAGAAACTTGTACGAAGG - Intergenic
991866112 5:71064961-71064983 AGAGAGAGAAACGGGCACGGTGG + Intronic
991884352 5:71245967-71245989 GGCAAAAGAAACTTGTACGAAGG + Intergenic
991910265 5:71552723-71552745 GGCAGGAGAACCAGGCAGGGAGG + Intronic
992415959 5:76551757-76551779 GGCAGGAGAATCAGGCAGGGAGG + Intronic
992463956 5:76985797-76985819 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
992574307 5:78096103-78096125 GGCAGGAGAATCAGGCAGGGAGG - Intronic
992600328 5:78391910-78391932 GGCAGGAGAATCAGGCAGGGAGG + Intronic
992801602 5:80300663-80300685 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
992964358 5:81984330-81984352 GGCAGGAGAATCAGGCAGGGAGG + Intronic
992977851 5:82138945-82138967 GGCAGGAGAATCAGGCAGGGAGG - Intronic
993560473 5:89401229-89401251 TGCAACAGACACTGGCACGTGGG + Intergenic
993658041 5:90596693-90596715 GGCAGGAGAATCAGGCAGGGCGG + Intronic
993668140 5:90726696-90726718 GGGAAGAGGAACTGGCAATGGGG - Intronic
993934535 5:93985516-93985538 GGCAGGAGAATCAGGCAGGGAGG - Intronic
995123766 5:108560033-108560055 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
995162001 5:108993442-108993464 GGCAGGAGAATCAGGCAGGGAGG + Intronic
995193136 5:109340743-109340765 GGCAGGAGAATCAGGCAGGGAGG - Intronic
995456708 5:112360366-112360388 GGCAGGAGAATCAGGCAGGGAGG - Intronic
995515816 5:112954302-112954324 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
996070219 5:119123206-119123228 GGCAGGAGAATCAGGCAGGGAGG + Intronic
996159748 5:120147514-120147536 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
996386431 5:122914013-122914035 GGCAGGAGAATCAGGCAGGGAGG + Intronic
996792809 5:127311148-127311170 AGTATGAGAAACTGGCAGGGAGG - Intronic
997321788 5:132983834-132983856 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
997565453 5:134882743-134882765 GGCAGGAGAATCAGGCAGGGAGG + Intronic
997636163 5:135408670-135408692 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
998022020 5:138777761-138777783 GGCAGGAGAATCAGGCAGGGAGG + Intronic
998053484 5:139055763-139055785 GGCAGGAGAATCAGGCAGGGAGG - Intronic
998059928 5:139111937-139111959 GGCAGGAGAATCAGGCAGGGAGG - Intronic
998067288 5:139169959-139169981 GGCAGGAGAATCAGGCAGGGAGG - Intronic
998074306 5:139223970-139223992 GGCAGGAGAATCAGGCAGGGAGG - Intronic
998239638 5:140428539-140428561 GGCAGGAGAATCAGGCAGGGAGG + Intronic
998432358 5:142077235-142077257 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
999181283 5:149671299-149671321 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
999604334 5:153297683-153297705 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
999813583 5:155152808-155152830 GTCAAGAGAAACTGACACCTAGG - Intergenic
999978909 5:156940049-156940071 GGCAGGAGAATCAGGCAGGGAGG - Intronic
999986857 5:157013635-157013657 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1000032789 5:157419041-157419063 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1000103589 5:158037898-158037920 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1000159001 5:158581890-158581912 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1000630400 5:163584488-163584510 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1001060469 5:168484112-168484134 GGCAAGACAGAATGGGACGGTGG - Intergenic
1001078066 5:168644321-168644343 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1001726352 5:173905147-173905169 GCCAAGAGAAACTGGCAGTGGGG + Intronic
1002008180 5:176253042-176253064 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1002013483 5:176304290-176304312 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1002031396 5:176433214-176433236 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1002115599 5:176960734-176960756 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1002529533 5:179835589-179835611 GGCAAGAGAATCAGGCAGGGAGG + Intronic
1002626317 5:180531887-180531909 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1003319618 6:5038780-5038802 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1003362564 6:5442689-5442711 GCCAAGGGAAACTGTCACCGAGG - Intronic
1004415146 6:15416591-15416613 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1004448979 6:15727220-15727242 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1004629363 6:17406841-17406863 GGCCAGAGGAACTGGAAAGGGGG - Intronic
1004664408 6:17736381-17736403 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1005063749 6:21798274-21798296 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1005158592 6:22835827-22835849 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1005414631 6:25586857-25586879 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1005550724 6:26911794-26911816 GGCAAAAGAAACTTGTACGAAGG + Intergenic
1005607211 6:27486342-27486364 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1005624741 6:27652995-27653017 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1005644871 6:27828379-27828401 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1005837044 6:29717990-29718012 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1005865196 6:29932156-29932178 GGCAGGAGAATCGGGCAGGGAGG - Intergenic
1005929677 6:30474574-30474596 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1006065247 6:31456406-31456428 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006128685 6:31855260-31855282 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006141662 6:31933019-31933041 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1006210071 6:32385996-32386018 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006225215 6:32531636-32531658 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1006232586 6:32596690-32596712 GGCAGGAGAATCAGGCAGGGCGG + Intergenic
1006282042 6:33060656-33060678 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006346464 6:33486466-33486488 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006403985 6:33833449-33833471 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1006546500 6:34785919-34785941 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1006617407 6:35339838-35339860 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1006826707 6:36941113-36941135 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1007651367 6:43424752-43424774 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1008106455 6:47444539-47444561 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1008112363 6:47506694-47506716 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1008184487 6:48371964-48371986 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1008480543 6:51981438-51981460 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1008553907 6:52656823-52656845 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1008624906 6:53306107-53306129 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1008841763 6:55910890-55910912 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1008919091 6:56824101-56824123 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1008926773 6:56895920-56895942 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1009048934 6:58257216-58257238 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1009217749 6:60944393-60944415 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1009622814 6:66097487-66097509 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010030636 6:71267298-71267320 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010192198 6:73206252-73206274 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010246141 6:73661602-73661624 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010264572 6:73851856-73851878 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010300769 6:74255868-74255890 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1010400756 6:75442657-75442679 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1011148805 6:84245517-84245539 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1011297092 6:85838041-85838063 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1011426981 6:87240255-87240277 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1011474358 6:87736724-87736746 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1011476265 6:87751987-87752009 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1011587924 6:88946747-88946769 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1012428542 6:99141469-99141491 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1012479531 6:99650935-99650957 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1012899745 6:104991913-104991935 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1012983851 6:105854791-105854813 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1013056414 6:106587595-106587617 GAGAAGAGAAACTGGCTAGGTGG + Intronic
1013190764 6:107802836-107802858 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1013204408 6:107933813-107933835 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1013243746 6:108269307-108269329 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1013325840 6:109046186-109046208 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1013530937 6:111018116-111018138 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1013800001 6:113931679-113931701 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1013958061 6:115863295-115863317 GACAAGTGAAACAGGCATGGAGG - Intergenic
1014123282 6:117750481-117750503 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1014463788 6:121730304-121730326 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1014557298 6:122850193-122850215 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1014764396 6:125390030-125390052 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1015069574 6:129075312-129075334 GGCATGAGATGCTGTCACGGAGG + Intronic
1015643842 6:135364795-135364817 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1015843272 6:137494733-137494755 GGCAAGAGAAGGTGGCCAGGCGG + Intergenic
1016123776 6:140374569-140374591 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1016476607 6:144434246-144434268 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1016480019 6:144470929-144470951 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1017063337 6:150507060-150507082 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1017170249 6:151449741-151449763 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1017465013 6:154686768-154686790 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1017493999 6:154967286-154967308 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1017660508 6:156669728-156669750 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1017851681 6:158309792-158309814 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1017981766 6:159406834-159406856 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1018295161 6:162338355-162338377 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019438936 7:1037347-1037369 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019445585 7:1069452-1069474 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019459291 7:1147865-1147887 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1019651399 7:2161199-2161221 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019668854 7:2267415-2267437 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019674281 7:2302195-2302217 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1019715166 7:2535191-2535213 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1019981196 7:4623441-4623463 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1020157137 7:5736210-5736232 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1020326173 7:6976039-6976061 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1020498738 7:8890052-8890074 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1020831556 7:13102046-13102068 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1021120569 7:16790940-16790962 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1021440074 7:20667814-20667836 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1021647228 7:22800339-22800361 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1021672626 7:23047279-23047301 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1021735161 7:23635975-23635997 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1022083124 7:27044173-27044195 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1022187720 7:27986748-27986770 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1022273951 7:28838284-28838306 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1023160428 7:37292040-37292062 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1024304991 7:47922005-47922027 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1024309690 7:47958914-47958936 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1024538542 7:50459049-50459071 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1024625668 7:51207522-51207544 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1024931436 7:54668626-54668648 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1024989365 7:55221082-55221104 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1025011783 7:55403346-55403368 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1025775012 7:64553678-64553700 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1025778189 7:64576965-64576987 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1025793514 7:64717416-64717438 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1025796176 7:64739469-64739491 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1025808121 7:64855614-64855636 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1025828837 7:65033054-65033076 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1025979676 7:66394975-66394997 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1026783607 7:73285217-73285239 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1026862236 7:73797985-73798007 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1027183103 7:75953222-75953244 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1027374144 7:77534763-77534785 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1027826665 7:83124847-83124869 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1027868940 7:83681664-83681686 GACAGGAGAGACTGGCACGAGGG - Intergenic
1028227611 7:88267297-88267319 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1028595819 7:92545715-92545737 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1029279296 7:99426282-99426304 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1029334741 7:99889112-99889134 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1029393205 7:100288944-100288966 GGGAAGAGCAACTGCCACAGTGG - Intergenic
1029430287 7:100524469-100524491 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1029469129 7:100742759-100742781 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1029525561 7:101091880-101091902 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1029569471 7:101360199-101360221 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1030036471 7:105411648-105411670 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1030288154 7:107847645-107847667 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1030602586 7:111609402-111609424 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1030706480 7:112697931-112697953 GGCAGGAGAATCCGGCAGGGAGG + Intergenic
1030919912 7:115370322-115370344 GGCAAGAGATAATGGAAAGGGGG - Intergenic
1032028508 7:128462956-128462978 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1032043055 7:128577595-128577617 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1032056521 7:128688893-128688915 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1032157061 7:129477078-129477100 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1032290935 7:130590348-130590370 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1032569392 7:132984155-132984177 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1032589240 7:133177069-133177091 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1033173033 7:139100935-139100957 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1033219899 7:139520951-139520973 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1033323607 7:140361641-140361663 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1033332967 7:140431071-140431093 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1033565550 7:142575017-142575039 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1034034290 7:147802679-147802701 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1034233824 7:149553636-149553658 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1034322354 7:150197947-150197969 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1034639010 7:152587136-152587158 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1034723700 7:153316062-153316084 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1034961971 7:155368337-155368359 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1035217255 7:157377479-157377501 GTCTAGAGAAACTGCCACTGGGG + Intronic
1035828879 8:2673208-2673230 AGCAAGAGAAACAGGGAAGGTGG - Intergenic
1036737054 8:11329406-11329428 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1037134733 8:15446630-15446652 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1037756418 8:21712910-21712932 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1037873853 8:22527355-22527377 AGCAAGAAAATCTGGCACAGAGG - Intronic
1037929455 8:22869224-22869246 GACAAGAGGCACTGGCACAGGGG - Intronic
1038594957 8:28880351-28880373 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1038745033 8:30247786-30247808 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1039072425 8:33659126-33659148 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1039153546 8:34530099-34530121 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1039201162 8:35094978-35095000 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1039548651 8:38428107-38428129 GCCAAGAGAGACAGGCAGGGTGG + Intronic
1039753315 8:40497130-40497152 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1039881345 8:41627169-41627191 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1040041486 8:42919845-42919867 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1040043668 8:42940385-42940407 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1040053009 8:43033878-43033900 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1040070168 8:43180996-43181018 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1040093522 8:43420395-43420417 GGCAGGAGAATCAGGCAAGGAGG + Intergenic
1040121484 8:43688543-43688565 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1040294758 8:46143390-46143412 GGCAAGAGACACAGGCACCCTGG + Intergenic
1040616402 8:49042194-49042216 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1040785341 8:51158543-51158565 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1040818493 8:51533586-51533608 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1041066124 8:54085093-54085115 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1041270641 8:56105514-56105536 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1041287147 8:56272886-56272908 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1041357895 8:57021326-57021348 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1041513735 8:58677152-58677174 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1041796817 8:61753974-61753996 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1041921004 8:63180877-63180899 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1042133862 8:65616225-65616247 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1042139181 8:65662190-65662212 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1042195912 8:66231755-66231777 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1042290888 8:67168200-67168222 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1042303388 8:67310200-67310222 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1042475528 8:69245110-69245132 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1042789892 8:72593399-72593421 GGCAAAAGAAACTGGCTCTGTGG + Intronic
1042912690 8:73844241-73844263 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1043723840 8:83583530-83583552 GGGAAGCAAAACTGGCACTGAGG - Intergenic
1043958695 8:86390597-86390619 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1043986169 8:86695200-86695222 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1044393708 8:91683321-91683343 GGCTAAAGAAGCTGGCATGGAGG + Intergenic
1044597348 8:93971316-93971338 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1044969289 8:97604447-97604469 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1045195510 8:99926712-99926734 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1045235647 8:100350851-100350873 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1045294263 8:100860255-100860277 GGCAAGCGCACCAGGCACGGGGG + Intergenic
1046599121 8:116297148-116297170 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1046636116 8:116678082-116678104 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1046735931 8:117777202-117777224 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1047388750 8:124432734-124432756 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1048368224 8:133756999-133757021 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1048718141 8:137291413-137291435 GGCAAGAGAGACCAGCAGGGAGG - Intergenic
1049177569 8:141203053-141203075 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1049481765 8:142827712-142827734 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1049485460 8:142856880-142856902 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1049892557 9:83818-83840 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1049976153 9:862404-862426 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1050534769 9:6622334-6622356 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1050557214 9:6799468-6799490 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1050558015 9:6806991-6807013 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1050572018 9:6949745-6949767 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1050862188 9:10449132-10449154 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1051257905 9:15233448-15233470 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1051281199 9:15443074-15443096 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1051430787 9:16978234-16978256 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1051662040 9:19434676-19434698 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1052236356 9:26215800-26215822 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1052338488 9:27342559-27342581 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1052492992 9:29189915-29189937 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1052880895 9:33600380-33600402 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1052887866 9:33667202-33667224 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1052928539 9:34038375-34038397 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1052941758 9:34136931-34136953 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1053047963 9:34936161-34936183 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1054359569 9:64100440-64100462 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1055137702 9:72842264-72842286 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1055241932 9:74196937-74196959 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1055297856 9:74852584-74852606 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1055506525 9:76954956-76954978 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1055519037 9:77061506-77061528 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1055580712 9:77703725-77703747 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1055585897 9:77760299-77760321 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1055948114 9:81709643-81709665 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1056076018 9:83041146-83041168 GGCCAGAGCACCGGGCACGGTGG - Intronic
1056097661 9:83272196-83272218 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1056152344 9:83803345-83803367 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1056166652 9:83947606-83947628 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1056409440 9:86311712-86311734 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1056561518 9:87733935-87733957 GGCAAGAGAAACAGGGAGGGGGG + Intergenic
1056564565 9:87759797-87759819 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1056625020 9:88245846-88245868 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1056670711 9:88625584-88625606 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1057155258 9:92832362-92832384 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1057630643 9:96716418-96716440 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1058018692 9:100067283-100067305 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1058244344 9:102604173-102604195 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1058390560 9:104490482-104490504 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1058660112 9:107258400-107258422 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1058722355 9:107775459-107775481 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1058972781 9:110098064-110098086 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1059118269 9:111618148-111618170 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1059120621 9:111640029-111640051 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1059245370 9:112845213-112845235 GACAAGAGCAACAGGCAAGGAGG + Intronic
1059707937 9:116841280-116841302 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1059880096 9:118678950-118678972 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1060334662 9:122710881-122710903 GGCAGGAGAATCAGGCACGGAGG - Intergenic
1060349938 9:122851589-122851611 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1060351632 9:122866497-122866519 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1060369813 9:123057956-123057978 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1060651284 9:125329026-125329048 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1060669938 9:125459718-125459740 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1060682185 9:125576611-125576633 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1060686892 9:125622899-125622921 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1060704035 9:125781423-125781445 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1060781760 9:126418205-126418227 GGGAAGAGAACCTGGGGCGGGGG + Intronic
1061142937 9:128779610-128779632 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1061427295 9:130507259-130507281 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1061635672 9:131907311-131907333 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1061977158 9:134075252-134075274 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1203464174 Un_GL000220v1:69252-69274 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1203562480 Un_KI270744v1:70869-70891 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1203634546 Un_KI270750v1:97911-97933 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1186514553 X:10156854-10156876 GGCGAATGACACTGGCACGGCGG + Intergenic
1186586245 X:10876241-10876263 GGCAAGAGAAAGAGGAACTGTGG + Intergenic
1186786734 X:12962734-12962756 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1186923107 X:14303363-14303385 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1187062251 X:15797977-15797999 CGCCAGAGAACCTGGCACAGAGG - Intronic
1187183855 X:16966013-16966035 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1187184475 X:16969629-16969651 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1187212691 X:17245707-17245729 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1188086269 X:25905349-25905371 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1188368130 X:29335166-29335188 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1188476934 X:30601595-30601617 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1188492845 X:30754669-30754691 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1189210048 X:39276981-39277003 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1189342065 X:40211674-40211696 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1189505712 X:41611791-41611813 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1189570183 X:42286521-42286543 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1189587422 X:42474876-42474898 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1189825431 X:44911930-44911952 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1189838225 X:45042155-45042177 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1189882291 X:45504782-45504804 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1189955646 X:46274812-46274834 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1189968759 X:46396902-46396924 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1190158899 X:48016397-48016419 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1190171354 X:48114734-48114756 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1190174596 X:48138662-48138684 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1190184385 X:48221881-48221903 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1190241542 X:48660471-48660493 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1190397908 X:50003434-50003456 GGCAAGAGGCACTGGCCTGGGGG - Intronic
1190505422 X:51120390-51120412 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1190520957 X:51279389-51279411 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1190681079 X:52827680-52827702 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1190769464 X:53503500-53503522 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1190778809 X:53577611-53577633 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1190793474 X:53721230-53721252 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1190820151 X:53966324-53966346 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1190839320 X:54129923-54129945 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1190848392 X:54215283-54215305 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1190891665 X:54573410-54573432 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1190906671 X:54735889-54735911 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1191009723 X:55747960-55747982 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1191069151 X:56381069-56381091 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1191637209 X:63392527-63392549 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1191679501 X:63826221-63826243 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1191828551 X:65391858-65391880 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1191835211 X:65456531-65456553 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1191894337 X:65975947-65975969 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1192106839 X:68325958-68325980 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1192129980 X:68540681-68540703 AGGAAGAGAAGCTGGCACTGAGG + Intergenic
1192324684 X:70122536-70122558 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1192353052 X:70372546-70372568 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1192500296 X:71645771-71645793 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1192530386 X:71877648-71877670 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1192567543 X:72178035-72178057 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1192610102 X:72559164-72559186 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1192739773 X:73881779-73881801 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1192761155 X:74097862-74097884 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1192768366 X:74165803-74165825 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1192970058 X:76219113-76219135 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1193067915 X:77278795-77278817 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1193115007 X:77767123-77767145 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1193132569 X:77932808-77932830 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1193164777 X:78266343-78266365 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1193328848 X:80214592-80214614 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1193345416 X:80397832-80397854 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1193362044 X:80590481-80590503 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1193372200 X:80712241-80712263 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1193890136 X:87033876-87033898 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1194181057 X:90713201-90713223 GGCACGAGAATCAGGCAGGGAGG - Intergenic
1194714833 X:97276180-97276202 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1195009659 X:100723212-100723234 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1195888815 X:109670718-109670740 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1196020536 X:110986332-110986354 GGGAAGAGAAATTGACATGGGGG + Intronic
1196096966 X:111810198-111810220 GGCAAAAGAGGCAGGCACGGTGG - Intronic
1196340079 X:114584934-114584956 GTCTAGAGAACCTGGCGCGGGGG + Intronic
1196389288 X:115191413-115191435 GGCCAGAGCAACTGCTACGGAGG + Exonic
1196778383 X:119361488-119361510 GGCAGGAGAACCAGGCAGGGAGG - Intergenic
1197199153 X:123733619-123733641 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1197277826 X:124500473-124500495 GGCAGAAGAAACTGGAAAGGAGG - Intronic
1197452790 X:126640846-126640868 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1197455512 X:126673311-126673333 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1197670016 X:129266349-129266371 TGCAAGACAAACTGGCAGGTGGG - Intergenic
1197735767 X:129849874-129849896 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1198108787 X:133484554-133484576 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1198129127 X:133676370-133676392 GGGCAGAGACACTGGCACAGGGG + Intronic
1198189272 X:134286613-134286635 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1198246706 X:134838786-134838808 GGCAGGAGAATCAGGCAGGGAGG - Intronic
1198260285 X:134959832-134959854 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1198476723 X:137001571-137001593 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1199173386 X:144757489-144757511 GGCAGGAGAAAATGGCACAATGG + Intergenic
1199230820 X:145435719-145435741 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1199452867 X:147993309-147993331 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1199634005 X:149798353-149798375 AGAAAGAGAGACTGGCAAGGTGG + Intergenic
1200387563 X:155908442-155908464 GGCAGGAGAATCAGGCAGGGAGG + Intronic
1200527677 Y:4295090-4295112 GGCACGAGAATCAGGCAGGGAGG - Intergenic
1200953054 Y:8918800-8918822 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1201335651 Y:12878225-12878247 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1201440385 Y:14001465-14001487 GGCAGGAGAATCAGGCAGGGAGG + Intergenic
1201444186 Y:14041243-14041265 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1201948177 Y:19535292-19535314 GGCAGGAGAATCAGGCAGGGAGG - Intergenic
1202168087 Y:22013912-22013934 GGCAAGAAAAACTGGCTTTGTGG + Intergenic
1202223274 Y:22572456-22572478 GGCAAGAAAAACTGGCTTTGTGG - Intergenic
1202319841 Y:23623204-23623226 GGCAAGAAAAACTGGCTTTGTGG + Intergenic
1202550927 Y:26046852-26046874 GGCAAGAAAAACTGGCTTTGTGG - Intergenic