ID: 1142408680

View in Genome Browser
Species Human (GRCh38)
Location 16:89905129-89905151
Sequence GATGAGGGTCCCTGAGGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 376}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142408680_1142408698 15 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408698 16:89905167-89905189 TCGCATTCGGGAGGCGAGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 35
1142408680_1142408688 -10 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408688 16:89905142-89905164 GACCCTCATCCCAGACACGGGGG 0: 1
1: 0
2: 1
3: 10
4: 149
1142408680_1142408699 30 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408699 16:89905182-89905204 GAGAAGGGCTGTGAGCAGCTTGG 0: 1
1: 1
2: 5
3: 63
4: 412
1142408680_1142408693 2 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408693 16:89905154-89905176 AGACACGGGGGCCTCGCATTCGG 0: 1
1: 0
2: 0
3: 2
4: 87
1142408680_1142408697 14 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408697 16:89905166-89905188 CTCGCATTCGGGAGGCGAGAAGG 0: 1
1: 0
2: 0
3: 2
4: 62
1142408680_1142408695 6 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408695 16:89905158-89905180 ACGGGGGCCTCGCATTCGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 16
1142408680_1142408694 3 Left 1142408680 16:89905129-89905151 CCCCCTCCTCAGGGACCCTCATC 0: 1
1: 0
2: 5
3: 43
4: 376
Right 1142408694 16:89905155-89905177 GACACGGGGGCCTCGCATTCGGG 0: 1
1: 0
2: 0
3: 2
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142408680 Original CRISPR GATGAGGGTCCCTGAGGAGG GGG (reversed) Intronic
900346716 1:2213759-2213781 GATGACTGTCCCCGAGCAGGGGG + Intergenic
900571570 1:3361232-3361254 GAGGAGGGTCCCAGGGGAGACGG - Intronic
901629915 1:10643010-10643032 CACGGGGGTCCCTGAGGAAGTGG + Intronic
902275855 1:15338746-15338768 GGTGAGGGTGTCAGAGGAGGGGG - Intronic
903413963 1:23168744-23168766 GGTGAGGGTCCGTGAGGCGGCGG - Exonic
904401847 1:30262102-30262124 GATGATGGGCACTGGGGAGGGGG - Intergenic
904801682 1:33097526-33097548 CATGAGGGTCCCAGAGCAGAGGG - Intronic
905775127 1:40663468-40663490 CTGGAGGGTCCCTGGGGAGGGGG - Intronic
905863798 1:41366217-41366239 GATGGGGGTGCGGGAGGAGGCGG + Intronic
905879825 1:41456153-41456175 GATGAGGGAACCTGGGAAGGAGG - Intergenic
906242086 1:44248323-44248345 GAGGAGGGCTCCTGAGAAGGAGG - Intronic
906782510 1:48585272-48585294 GATGAGGGTCCCTCCAGAGGAGG - Intronic
908488574 1:64619634-64619656 GATGAGGGTACCTGAGAGAGAGG - Intronic
910463588 1:87473541-87473563 GATAAGGCTCCCTGCGGAGTTGG + Intergenic
910929174 1:92425658-92425680 GAAGAGGGTACCTGGGGACGAGG + Intergenic
911836247 1:102622889-102622911 GATGAAGCTCCCAGAGGAAGGGG - Intergenic
912459634 1:109822151-109822173 GCTGAGGGTCCATGTGGGGGTGG + Intergenic
913597540 1:120393265-120393287 GAAGAGGGTCCCAGGGGAGCAGG - Intergenic
913670440 1:121093285-121093307 TATGATGGTCCCTCAGGGGGAGG - Intronic
914022207 1:143880726-143880748 TATGATGGTCCCTCAGGGGGAGG - Intergenic
914089790 1:144486049-144486071 GAAGAGGGTCCCAGGGGAGCAGG + Intergenic
914308820 1:146448167-146448189 GAAGAGGGTCCCAGGGGAGCAGG - Intergenic
914512507 1:148346323-148346345 GAAGAGGGTCCCAGGGGAGCAGG + Intergenic
914593288 1:149124964-149124986 GAAGAGGGTCCCAGGGGAGCAGG + Intergenic
914660692 1:149788652-149788674 TATGATGGTCCCTCAGGGGGAGG - Intronic
914810676 1:151025503-151025525 GATGATGGTTCCTGTGGAGAAGG - Exonic
915316985 1:155034273-155034295 GATGAGGGAGCCTGAGGAAGTGG - Intronic
918179206 1:182071307-182071329 GAGGTGGGTCCCTTAGGATGAGG - Intergenic
919920003 1:202161948-202161970 GGTGGGTTTCCCTGAGGAGGAGG + Intergenic
920186413 1:204162025-204162047 GGTGAGGATCACGGAGGAGGTGG + Exonic
920331598 1:205211943-205211965 TATGAGCGTCCCTGAGGAGAGGG + Intergenic
920849001 1:209615927-209615949 GAAGAGGGTTGCTGAGGAGCTGG - Intronic
921580014 1:216885415-216885437 GATGAGGGGTGCTGAGGAGCAGG + Intronic
922784445 1:228276129-228276151 GAGGAGGGGCACTGAGGAAGAGG + Intronic
923516053 1:234698782-234698804 GCTGTGGGCCCCTGAGCAGGCGG - Intergenic
923742091 1:236664289-236664311 GCTGAGGGTACCAGAGGAAGAGG - Intergenic
924538895 1:244962597-244962619 GATGAGGGGCACTGTGAAGGGGG - Intergenic
1063051815 10:2457746-2457768 GGAGAGGCACCCTGAGGAGGGGG + Intergenic
1063191293 10:3697233-3697255 GACCAGGGTTCCTGGGGAGGAGG - Intergenic
1064436091 10:15312508-15312530 GGAGAGGGTCCCTGAGAAGGTGG - Intronic
1066349073 10:34620036-34620058 GAGTGGGGTCTCTGAGGAGGAGG - Intronic
1067068067 10:43114736-43114758 GGTGAGGGTCCCTGCGGGGCAGG + Exonic
1067582024 10:47452107-47452129 ACTGAGGGTCCAAGAGGAGGCGG - Intergenic
1067682304 10:48448803-48448825 GATGAGGTTCCCAGAGGAAAAGG - Intronic
1068384632 10:56309394-56309416 GATGGGGGTCCCTTTGTAGGTGG + Intergenic
1069455035 10:68547373-68547395 CATGATGATCTCTGAGGAGGCGG + Intergenic
1069908504 10:71746242-71746264 GATGTGGCTCCCTAAGCAGGGGG + Intronic
1070837922 10:79462718-79462740 GATGAAGGTATCTCAGGAGGAGG + Intergenic
1072260235 10:93663126-93663148 GATGAAGGTCATTGAAGAGGAGG + Exonic
1075042360 10:119118467-119118489 CTTCAGGGTCCCTGAGCAGGAGG + Intronic
1075857034 10:125638252-125638274 GCTGAGGCTGCCTGAGGATGGGG - Intronic
1076402225 10:130191709-130191731 AATGAGTGTCCCTGAGGGGGAGG + Intergenic
1076756990 10:132577675-132577697 CAGGAGGGCCCCTGAGGAGATGG + Intronic
1077282862 11:1753447-1753469 GAGGAGAGTCCCAGAGCAGGAGG - Exonic
1077327991 11:1971904-1971926 GAGAAGGGTCCCTGAGGAGGTGG - Intronic
1077410726 11:2402786-2402808 GATGGGGCTGCCTGGGGAGGAGG + Exonic
1077860403 11:6172945-6172967 GATGTGGATACCTGGGGAGGGGG + Intergenic
1077881568 11:6354660-6354682 GGTCAGGGTCCCTGAGGAATGGG - Intergenic
1078211059 11:9269774-9269796 GGGCAGTGTCCCTGAGGAGGCGG - Intergenic
1078329695 11:10409303-10409325 GCTGAGGGCCCCTGAGGACAGGG - Intronic
1079129060 11:17737112-17737134 GAGGCTGCTCCCTGAGGAGGGGG - Intronic
1080004140 11:27387380-27387402 ACTGAGGGACTCTGAGGAGGAGG + Intronic
1081166138 11:39810748-39810770 GATGAAGCTCCCAGAGGAAGGGG + Intergenic
1081605525 11:44525013-44525035 GAAGGGGGTCACTGAGGGGGAGG + Intergenic
1081620495 11:44616465-44616487 GAAGTGGGTCCCTTGGGAGGTGG + Intronic
1082295825 11:50440133-50440155 GATGAGGGAAACTGAGGTGGAGG - Intergenic
1083407837 11:62471096-62471118 GATGATGGCCCATGGGGAGGTGG + Intronic
1083664476 11:64267139-64267161 GCTGAGGGGCCCTGAGGGAGGGG - Intronic
1083822799 11:65182229-65182251 GCTGCGGGGGCCTGAGGAGGGGG + Intronic
1084174764 11:67417467-67417489 GAAGAGGGCCCCTGGGGAGGGGG + Exonic
1084322960 11:68383809-68383831 GAACAGCTTCCCTGAGGAGGAGG + Intronic
1084540325 11:69782366-69782388 GCTGGGAGACCCTGAGGAGGAGG - Intergenic
1084582349 11:70031953-70031975 AATGATGGACCGTGAGGAGGGGG - Intergenic
1084775042 11:71369453-71369475 GATGAGGGTCCATGCAGCGGCGG - Intergenic
1086113629 11:83224391-83224413 GATGAGGGTCACCGAAGAGCAGG - Intronic
1086286934 11:85261804-85261826 GAGAAGGGTCCCTGATAAGGAGG + Intronic
1087524250 11:99287976-99287998 GATAAGGGTCCTTGAGAATGTGG - Intronic
1089331108 11:117689634-117689656 GATGTGGGTCCCAGGGCAGGAGG - Intronic
1089395822 11:118135950-118135972 GAAGAGAGTCCCTGAGGCGAAGG + Exonic
1089492388 11:118892200-118892222 AATGAGGGTCTGTGAGAAGGAGG - Intronic
1089500829 11:118930241-118930263 GTTGAGGGTCACAGAGGACGGGG - Intronic
1089780418 11:120869742-120869764 GAAGAGGGGGCCTGGGGAGGGGG + Intronic
1090407685 11:126486965-126486987 TATGAGGCTCGTTGAGGAGGTGG - Intronic
1090833334 11:130435627-130435649 GAAGAGAGACCCTGAGGATGAGG - Intergenic
1202810970 11_KI270721v1_random:27084-27106 GAGAAGGGTCCCTGAGGAGGTGG - Intergenic
1091393205 12:138529-138551 GGTGAGGGTGCCTGCGAAGGTGG - Exonic
1092218399 12:6697709-6697731 GATGAAGAGCCCTGAGCAGGCGG + Exonic
1092230348 12:6772615-6772637 GATCAGGCAGCCTGAGGAGGTGG - Exonic
1092252413 12:6907303-6907325 GATGCTGTTCCCTGGGGAGGAGG - Exonic
1092998500 12:13973566-13973588 GCCCAGGGTCCCTGAGAAGGCGG - Intronic
1093079101 12:14788977-14788999 GGTGGGGGTCCACGAGGAGGGGG + Exonic
1101053053 12:100884368-100884390 CATGGGGGGCCCTGTGGAGGAGG - Intronic
1102248042 12:111367619-111367641 GAGGAGGGTTGCTGAGCAGGAGG - Intronic
1102813580 12:115844325-115844347 CATGAGGATACCTGGGGAGGTGG - Intergenic
1102908459 12:116694924-116694946 AATGAGGGCCCCTGATAAGGAGG + Intergenic
1103150352 12:118632894-118632916 AATGAGGGTCCATGTGGAAGAGG + Intergenic
1103443123 12:120978362-120978384 GGTGAGGGGCCCTGAGCAGCTGG - Intergenic
1103761631 12:123254375-123254397 GATCCAAGTCCCTGAGGAGGCGG + Intronic
1104976997 12:132556615-132556637 GAGGAGCGTCCCACAGGAGGGGG - Intronic
1105249112 13:18680599-18680621 GGTGGGGGCCCCCGAGGAGGAGG + Intergenic
1105795530 13:23848655-23848677 GATGAGGCTCCTAGAAGAGGGGG + Intronic
1107526741 13:41240244-41240266 GATGAGGTAACCTCAGGAGGAGG - Exonic
1107561217 13:41559073-41559095 GATGGTGGTAGCTGAGGAGGAGG + Intergenic
1109715426 13:66215708-66215730 GAAGAGGGTCCCTGTGGTGTAGG - Intergenic
1109922296 13:69081713-69081735 GATGAGGGGCACTGAGGAGCAGG + Intergenic
1110867119 13:80408088-80408110 GATGAAGGTCCCAGAGGAAGGGG - Intergenic
1113373263 13:109741446-109741468 GATGAGGGCACCTGGGGAAGGGG + Intergenic
1114584431 14:23797148-23797170 AATGAGGTACCCTGAGGAAGAGG + Intergenic
1114651972 14:24291034-24291056 GGTGAGGGTATCTGAGGAGTGGG - Intronic
1115043842 14:28965088-28965110 AATGAGGGTAGCTGAGTAGGTGG + Intergenic
1115497983 14:34025809-34025831 GAGAAAGGACCCTGAGGAGGAGG - Intronic
1117814660 14:59584593-59584615 GAGGAAGGTCCCTGAGGAGATGG - Intergenic
1120147861 14:80999446-80999468 GATGATGGAGCTTGAGGAGGTGG + Intronic
1120696810 14:87653962-87653984 GAAGAGGGAAGCTGAGGAGGGGG + Intergenic
1121448421 14:93992866-93992888 GCTGAGGGCCTCAGAGGAGGTGG + Intergenic
1122017129 14:98805693-98805715 GCTGAGGGTCGCTGAGGGGGCGG - Intergenic
1122217674 14:100214624-100214646 GACGAGGGGCCCCGGGGAGGAGG - Intergenic
1122266869 14:100550689-100550711 GATGTGGGTACCAGAGAAGGGGG + Intronic
1122416071 14:101550095-101550117 ACTGAGGGTCCGGGAGGAGGTGG - Intergenic
1122815884 14:104313782-104313804 CCTGAGGGTCCCTGAGGGGTGGG + Intergenic
1124168041 15:27346728-27346750 GATGAATGTCCTTGAGCAGGAGG - Intronic
1124437902 15:29666251-29666273 GATGAAGGTGGCTGGGGAGGAGG - Intergenic
1125205934 15:37153602-37153624 GATCAAGCTCCTTGAGGAGGTGG + Intergenic
1126031447 15:44503553-44503575 GAGGAAGGTCATTGAGGAGGTGG - Intronic
1127071179 15:55289694-55289716 GGTGAGGGGGCCTGAGGAGCGGG - Intronic
1127417589 15:58771989-58772011 GAACAGGGTCCCTGAGGAGGAGG + Exonic
1127587948 15:60396417-60396439 GAAGAGCGTCTCTAAGGAGGTGG + Intronic
1129188134 15:73922911-73922933 GAGGAGGGGGCCTGAGGAGGGGG - Intergenic
1129410399 15:75347729-75347751 TTTGGGGGGCCCTGAGGAGGAGG + Intronic
1129616390 15:77101677-77101699 GCTGAAGGACCCTGGGGAGGAGG + Exonic
1129693831 15:77729343-77729365 ACTGAGGGTCCTTGAGGAGGAGG + Intronic
1130020434 15:80226195-80226217 GAGGTGGGTCCCTGAGCTGGTGG + Intergenic
1130428813 15:83825859-83825881 GATGAGGCTACCAGTGGAGGTGG + Intronic
1131073034 15:89477749-89477771 GCTGAGGGTTCCTAGGGAGGGGG - Intronic
1131173246 15:90192981-90193003 GAGGAAGGTCCATGGGGAGGAGG + Intronic
1131174367 15:90201062-90201084 GCAGAGGGTCCCAGAGGAGCCGG + Intronic
1132285271 15:100658025-100658047 AGTGAGGGGCCCTGAGGAAGTGG - Intergenic
1132556584 16:575348-575370 GATGAGGTCCCCTGTGGAAGGGG - Intronic
1132585028 16:702356-702378 GCTGGGGGTCCCGGAGCAGGAGG - Intronic
1132882482 16:2168567-2168589 GAGGAGGGGTCCTGATGAGGCGG + Intronic
1132990582 16:2790770-2790792 GCTGAGGGACACAGAGGAGGGGG + Intergenic
1133053070 16:3129499-3129521 GTTGAGGTTCACTGAGGCGGCGG + Intergenic
1133699867 16:8298880-8298902 GATGAGTGCCCCTGAGGAAGGGG - Intergenic
1133742934 16:8664967-8664989 ACTGAGGGTCCCTGGGGAGGAGG + Intergenic
1134216311 16:12319507-12319529 TATGAGTGTCTCTGAAGAGGTGG - Intronic
1134222644 16:12367071-12367093 TGTGAGGGTCCCTGTGGAGTGGG + Intronic
1136540522 16:30925482-30925504 GGGAAGGGACCCTGAGGAGGCGG + Intronic
1136987446 16:35122448-35122470 GATGAGGGTACCTCAGCAGAAGG - Intergenic
1137018283 16:35397186-35397208 GATGAGGGGCAGGGAGGAGGTGG - Intergenic
1139329540 16:66176686-66176708 GGTGATGGTCACTGGGGAGGAGG - Intergenic
1139515519 16:67450345-67450367 GATTGGCTTCCCTGAGGAGGTGG - Intronic
1139618110 16:68113457-68113479 GATGAAGCTCCCAGAGGAGGAGG - Intronic
1139762207 16:69194196-69194218 AATGAGTGTGCCTGAGGATGGGG + Intronic
1140409789 16:74734684-74734706 GAGGAGGGGTCCTGGGGAGGGGG - Intronic
1141862560 16:86728007-86728029 GCTGAGAGTCCGTGGGGAGGGGG + Intergenic
1142121762 16:88390027-88390049 GCTGTGGGTCCCTTGGGAGGAGG - Intergenic
1142197396 16:88745141-88745163 GCAGTGGGTCCCTGCGGAGGTGG - Intronic
1142408680 16:89905129-89905151 GATGAGGGTCCCTGAGGAGGGGG - Intronic
1142520529 17:501544-501566 GATGTGGGGCCCTTAGGAGGTGG - Intergenic
1142616805 17:1141265-1141287 AATGGGGGGCCCTGAGAAGGAGG - Intronic
1142850318 17:2701569-2701591 GAAGAGGGTCCCTGGCGGGGTGG - Intronic
1143653066 17:8276198-8276220 CATGTGTGTCCCTCAGGAGGAGG - Intergenic
1143731600 17:8885484-8885506 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731669 17:8885648-8885670 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143731751 17:8885829-8885851 GAGGCGGGGCCCTGGGGAGGCGG - Intronic
1143894259 17:10124097-10124119 AATGGGGGCCCCTGAGGAGGCGG + Intronic
1144850435 17:18241388-18241410 GGTGAGGGGCCCTGGGGACGAGG + Intronic
1145826392 17:27880159-27880181 GAGAATGGTCCCTGTGGAGGAGG - Intronic
1147732923 17:42615044-42615066 GATGAGGGTCCCTGTCCTGGGGG - Exonic
1148333238 17:46824706-46824728 GATGATGGGCCCAGAGGAGAGGG + Intronic
1149200683 17:54182675-54182697 AGTGAGGGTGACTGAGGAGGTGG - Intergenic
1149563872 17:57628191-57628213 GAGGAGGCTCCCTGGGGAGCTGG + Intronic
1150604172 17:66676679-66676701 GATCAGATACCCTGAGGAGGAGG + Intronic
1151361200 17:73590126-73590148 GATGAGGGCCTTTGAGAAGGGGG + Intronic
1151678817 17:75613572-75613594 GATCAGGGTCACTGAGGACAGGG - Intergenic
1152369588 17:79878085-79878107 GATGATGGTCCGGGGGGAGGAGG + Intergenic
1152741729 17:82021391-82021413 GTTGGGGGTCCCGGAGCAGGTGG - Intronic
1152935249 17:83132889-83132911 GATGTGGGGCCCTGAGGAGTGGG - Intergenic
1153390538 18:4552732-4552754 TATGAGGGTGCCTGTGGTGGTGG - Intergenic
1153627955 18:7039769-7039791 GATGAGGCCCACAGAGGAGGTGG + Intronic
1154439773 18:14378631-14378653 GGTGGGGGCCCCCGAGGAGGAGG - Intergenic
1156012750 18:32513224-32513246 GGTGGGGGTTCCCGAGGAGGGGG - Intergenic
1157610374 18:48951745-48951767 GAGGAGAGTCTCGGAGGAGGAGG - Intergenic
1158763660 18:60421781-60421803 AATGGGGGTCCCTGAGGAAGCGG + Intergenic
1158863225 18:61613497-61613519 AATGAGGGTCTTTGAGAAGGTGG - Intergenic
1159004544 18:63000893-63000915 GATGAGTGTCCATGAGCATGGGG - Intergenic
1163312568 19:16522916-16522938 GATCAGGGTCCCTAGGGAGTGGG + Intronic
1163471511 19:17500095-17500117 GAGGAGGGGCCCTGAGTTGGAGG + Intronic
1164870108 19:31635980-31636002 GAGGAGGGTCCCTGAGACTGGGG - Intergenic
1165060113 19:33201071-33201093 GATGTGGGTCCCTGAGTGGACGG - Intronic
1165790862 19:38491351-38491373 AATGAGAGTCCCAGAGGAAGAGG - Intronic
1165830588 19:38728485-38728507 GAGGAGTGTCCCCGAGGACGAGG - Intronic
1165928682 19:39342665-39342687 GTTCGGGGTCCCTGAGGGGGCGG - Intronic
1167077930 19:47260439-47260461 GGTGTGGGACCCTGAGGATGGGG + Intronic
1167324897 19:48818393-48818415 TGAGAGGTTCCCTGAGGAGGAGG - Intronic
1167638845 19:50669122-50669144 GGTGAGGCGCCCTGAGGAGGAGG + Exonic
1167713290 19:51125247-51125269 TATGTGGGTCCCCAAGGAGGTGG - Exonic
925135089 2:1521477-1521499 GAGGAGGGTCCCTGGGGAGGAGG - Intronic
926778438 2:16445184-16445206 GGTTAGGGTCTCTCAGGAGGTGG - Intergenic
927142613 2:20140405-20140427 GATCAGAGCCCCTGCGGAGGGGG + Intergenic
927154138 2:20212169-20212191 GCTGTGGGTCCCTGAGGAGGGGG - Intronic
927250116 2:20989455-20989477 ATTGGGGGTCCCAGAGGAGGGGG + Intergenic
927810018 2:26175475-26175497 GATGAGGGGGCGTGGGGAGGGGG + Intronic
928086273 2:28348217-28348239 GTGGAGGTGCCCTGAGGAGGTGG + Intergenic
928099002 2:28423835-28423857 GAAGAGGGTCCCTGAGAAGAAGG - Intergenic
928217596 2:29375235-29375257 GCTGAGGGTCAGTGAGAAGGTGG - Intronic
929463687 2:42125835-42125857 CAGGAGGGGCCATGAGGAGGGGG + Intergenic
929803091 2:45121024-45121046 GATGAGGGTCATTGAGGAGAAGG + Intergenic
930024196 2:47020489-47020511 GATGAGGGTGTCTGGGGAGCTGG - Intronic
932274661 2:70442999-70443021 GATGAGAGTCGCTGGGGATGTGG + Intergenic
932906112 2:75754012-75754034 GTTGAGGGTCATTGAGGAGGAGG - Intergenic
933794606 2:85909508-85909530 GATGTGGCTGCCCGAGGAGGAGG - Intergenic
934120024 2:88829405-88829427 GATGAGGGTCAGTGAGGACGTGG + Intergenic
934330168 2:92057842-92057864 GAAGAGGGTAGCTGAGGAGAGGG + Intergenic
935131462 2:100264346-100264368 CATGCGGGCCTCTGAGGAGGTGG - Intergenic
935267476 2:101407291-101407313 GGTGAGGAGCACTGAGGAGGAGG - Intronic
935381044 2:102451451-102451473 GGTGGGGGTATCTGAGGAGGAGG - Intronic
935548474 2:104425923-104425945 GATGAGGTGCCCTGAAGTGGGGG + Intergenic
936161254 2:110085807-110085829 GCTGAGGGTACCTGAGGGGTGGG - Intronic
936183409 2:110285547-110285569 GCTGAGGGTACCTGAGGGGTGGG + Intergenic
937936443 2:127249302-127249324 GGTGGGGGTCCCCTAGGAGGGGG - Intergenic
937969071 2:127535886-127535908 GAAGAGGGTCGCTGGGCAGGAGG + Intronic
938224606 2:129605113-129605135 GGTGTGGGTCCCTGAGGGGACGG - Intergenic
938302670 2:130228214-130228236 GGGGAGGTTCCCAGAGGAGGAGG - Intergenic
938383373 2:130848846-130848868 GGTGATGGGCCCTGAAGAGGAGG + Intronic
943015082 2:182500313-182500335 GAGGAGGGTCAGTCAGGAGGGGG + Intronic
944267496 2:197744923-197744945 GAATGAGGTCCCTGAGGAGGAGG + Intronic
944580682 2:201130108-201130130 GGTGAGGGTTCCTGAGCAGGTGG - Exonic
944915600 2:204357484-204357506 AATGAGGTTTCGTGAGGAGGAGG + Intergenic
945357574 2:208857613-208857635 GATGGAGGTCCCAGAGGAAGGGG - Intergenic
946313430 2:218895401-218895423 GGTGAGAGTCCCCCAGGAGGAGG + Intronic
946409936 2:219510843-219510865 AATGAGAGTCCCAGAGAAGGGGG - Intergenic
1168865319 20:1081111-1081133 GCTTTGGGTCCCTGAGGAAGAGG - Intergenic
1171372015 20:24668469-24668491 TATGAGGATGCCTGGGGAGGTGG - Intergenic
1172429303 20:34876645-34876667 GATGGGGCTTCCTGAGGAGCGGG + Exonic
1172656719 20:36542277-36542299 GATGAGGTGCACTGAGAAGGAGG + Intronic
1173464031 20:43267274-43267296 GAAGAGGAGCCCTGAGGAGCCGG + Intergenic
1173858997 20:46269829-46269851 GCTGGAAGTCCCTGAGGAGGTGG - Intronic
1173873427 20:46355561-46355583 GATGAGGGTCCCAGCAGAGCTGG - Intronic
1173927424 20:46791213-46791235 CATGAGGGTCCCAGGGGAGGCGG + Intergenic
1174180136 20:48669263-48669285 GATGGGACTCTCTGAGGAGGTGG - Intronic
1175775667 20:61651965-61651987 GAGGAGAGTCCCGCAGGAGGAGG + Intronic
1176011919 20:62902013-62902035 TATGAAGGTCACTGAAGAGGTGG + Intronic
1176285313 21:5016235-5016257 AGGGAGGGTGCCTGAGGAGGAGG + Intergenic
1176428864 21:6564227-6564249 GCTGAGGGTCCAGAAGGAGGGGG + Intergenic
1176455971 21:6911142-6911164 GGTGGGGGCCCCCGAGGAGGAGG + Intergenic
1176834145 21:13776190-13776212 GGTGGGGGCCCCCGAGGAGGAGG + Intergenic
1177225143 21:18244649-18244671 GAGGAGGGGACCAGAGGAGGCGG + Intronic
1178508466 21:33182111-33182133 GATGGGGCTCCCTGAGAAGTTGG - Intergenic
1178891297 21:36523052-36523074 AGTGAGTGTCCCTGGGGAGGTGG - Intronic
1178958618 21:37044444-37044466 GATGGGGGTCCCTGGGTAGGGGG - Intergenic
1179704354 21:43172543-43172565 GCTGAGGGTCCAGAAGGAGGGGG + Exonic
1179732023 21:43373361-43373383 GAAGAGGGTGAGTGAGGAGGAGG - Intergenic
1179871868 21:44247240-44247262 AGGGAGGGTGCCTGAGGAGGAGG - Intronic
1179884040 21:44305935-44305957 GGTGAGGGTCCCTGAGGCCCTGG + Intronic
1179926853 21:44539446-44539468 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179928368 21:44550757-44550779 GAGGAGGGACACAGAGGAGGAGG + Exonic
1179929556 21:44558233-44558255 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179931653 21:44574828-44574850 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179932569 21:44579907-44579929 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179934115 21:44591564-44591586 GAGGAGGGACACGGAGGAGGAGG + Exonic
1179935516 21:44601535-44601557 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179937057 21:44612714-44612736 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179939284 21:44627851-44627873 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179940770 21:44637974-44637996 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179942123 21:44647156-44647178 GAGGAGGGACACAGAGGAGGAGG - Exonic
1179948699 21:44697773-44697795 GAGGAGGGACACGGAGGAGGAGG - Exonic
1179949643 21:44702602-44702624 GAGGAGGGACACAGAGGAGGAGG - Intronic
1180010916 21:45050662-45050684 GCAGAATGTCCCTGAGGAGGGGG - Intergenic
1180228855 21:46414389-46414411 GATGTGTGTCCCAGAGGAGAAGG - Intronic
1180864234 22:19106717-19106739 GATGTGGGACACTGAGTAGGCGG - Intronic
1181274996 22:21682600-21682622 TATGAGGGGCCCTGACGTGGGGG - Intronic
1181803686 22:25362619-25362641 GAACAGCTTCCCTGAGGAGGCGG - Intronic
1182756720 22:32686269-32686291 GATGAGGGTCCTGGAGCAGGAGG + Intronic
1183248967 22:36714799-36714821 AATGAGGCTCCGTGAGGGGGAGG - Intergenic
1183371418 22:37434682-37434704 ACTGACGGTCCCTGGGGAGGGGG + Intergenic
1183485342 22:38085184-38085206 GAAGCGGGTCCCTGAGACGGGGG - Exonic
1183489933 22:38110858-38110880 GGTTGGGGTCCTTGAGGAGGGGG - Intergenic
1184071905 22:42151942-42151964 GAGGAAGGGCCTTGAGGAGGAGG - Intergenic
1184130512 22:42514259-42514281 GGAGGGGGTCCCTGACGAGGAGG - Exonic
1184140688 22:42576081-42576103 GGAGGGGGTCCCTGACGAGGAGG - Intergenic
1184254981 22:43281504-43281526 CAGGAGGGTGGCTGAGGAGGAGG - Intronic
1184514959 22:44956207-44956229 GAGGAGGCTCCCTGGGGAGGGGG + Intronic
1184770783 22:46595403-46595425 GATGAGAGTCCCTTGGGTGGGGG - Intronic
1184863263 22:47188912-47188934 CAGGAGGGAGCCTGAGGAGGAGG + Intergenic
1185255316 22:49828117-49828139 AATGAGGGGCCCTGAGGCAGGGG + Intergenic
1185255453 22:49828473-49828495 AGTGGGGGTCCCTGAGGCGGGGG + Intergenic
1185272506 22:49935638-49935660 GATGGGGGTCCGGGAGGAGCAGG + Intergenic
1185409606 22:50674826-50674848 GGGGAGGGTCCCGGCGGAGGCGG - Intergenic
949892480 3:8743658-8743680 GCTGGGGATCCCTGAGGATGAGG - Intronic
950187260 3:10952746-10952768 GCTGAGGGTACCTGCAGAGGTGG + Intergenic
950215066 3:11153523-11153545 GAGGAGGGTGTTTGAGGAGGTGG - Intronic
950521914 3:13502392-13502414 CATTAGGGGTCCTGAGGAGGAGG - Intronic
953061128 3:39429471-39429493 GCTGGGGGTTCTTGAGGAGGAGG - Intergenic
954081929 3:48217523-48217545 TATGAGGGTCACTAAGCAGGGGG + Intergenic
954428045 3:50453968-50453990 GATGGGGCTCCGTGAGGCGGGGG - Intronic
954450072 3:50567030-50567052 TCTGATGGTCCCTGAGGAAGGGG + Intronic
955215624 3:56982902-56982924 GTTGATGGTCCCTGGGCAGGTGG - Intronic
956629697 3:71304070-71304092 GATGAGGGCCCCAGAGGATGAGG - Intronic
959506748 3:107164552-107164574 GATGGAGCTCCCAGAGGAGGGGG + Intergenic
960087451 3:113606336-113606358 GATCAGAGTCCCTGAGGGTGGGG + Intronic
960532531 3:118781232-118781254 CATGAAGTTGCCTGAGGAGGTGG + Intergenic
961906543 3:130268854-130268876 GAGGAAGGACCTTGAGGAGGTGG - Intergenic
962049367 3:131796607-131796629 GAAGGGGGACCCTGGGGAGGAGG - Intronic
962280554 3:134048798-134048820 GATGGCGGTCCCTGAGGACGCGG - Intronic
962853079 3:139322481-139322503 TATCAGGGTGCCTGTGGAGGTGG + Intronic
963335513 3:143971006-143971028 CCTGAGGGTCCCTGAGGAGCGGG - Intergenic
963757292 3:149248472-149248494 GATGTGGGATCCTGAGGAGATGG - Intergenic
964134469 3:153329002-153329024 GATGAGGGTGGCTCAGGATGAGG + Intergenic
964853051 3:161115753-161115775 CATGAGGGTTCCTGGAGAGGGGG + Intronic
965910785 3:173772770-173772792 GATGGGTGTCACTGAGGAGCAGG - Intronic
966854260 3:184183636-184183658 GAGGAGGGTGGCTGGGGAGGTGG - Exonic
967235759 3:187382409-187382431 GATGGGGGGCTCGGAGGAGGGGG - Intergenic
968090021 3:195893779-195893801 GCTGAGGCTCCCTGAGCTGGTGG - Intronic
968126470 3:196163957-196163979 GCTGTGGGTCCCGCAGGAGGTGG - Intergenic
968616699 4:1580689-1580711 GAGGCGGGTCCCTGAGCGGGAGG - Intergenic
969449050 4:7262660-7262682 AAGGAGGGCCTCTGAGGAGGGGG + Intronic
969520600 4:7675756-7675778 GATGTGGGACCAGGAGGAGGAGG + Intronic
970793641 4:19888652-19888674 GCTGAGGGTTCCTGCTGAGGGGG - Intergenic
972324310 4:38000842-38000864 AATGACTGACCCTGAGGAGGAGG - Intronic
972355856 4:38279167-38279189 GCAGAGGGACTCTGAGGAGGTGG - Intergenic
975139296 4:70903127-70903149 GACGGGGGTCCCTGAGAAAGGGG + Intronic
975190153 4:71451243-71451265 GATGGAGGTCACGGAGGAGGAGG + Exonic
979429985 4:120617683-120617705 GATGGGGGACCCTGTGGAGCTGG + Intergenic
985364787 4:189216871-189216893 GATGAGGGTGGGTGAGCAGGAGG + Intergenic
985773544 5:1827813-1827835 GAGGAGGGTCCCTCAGGAATGGG + Intergenic
985788962 5:1915263-1915285 GATGGGGGACCCAGAGGTGGGGG - Intergenic
985969965 5:3367363-3367385 AATGAGTGTCACTGAGGATGTGG - Intergenic
987590940 5:19925197-19925219 GATGAGTCTTCCTGAAGAGGAGG + Intronic
987887544 5:23831146-23831168 GATGGAGCTCCCAGAGGAGGTGG + Intergenic
989103850 5:37842573-37842595 GAGGATGGTCCCTCAGAAGGAGG + Intergenic
992344904 5:75866859-75866881 AGTGAGGGTCCCTGAGAAAGGGG + Intergenic
992636614 5:78730934-78730956 AACTAGGGTCCCTGAGGGGGAGG + Intronic
993732466 5:91438988-91439010 GGTGATGGTCCATGAGGAAGAGG + Intergenic
994318210 5:98359309-98359331 GATGAGGTTCCCTTTGTAGGTGG + Intergenic
996331974 5:122339920-122339942 GAGGAGTGTCACTGAGCAGGGGG + Intronic
997199713 5:132002504-132002526 GTTGGGGGTCACTGAGGTGGGGG + Intronic
997249951 5:132380909-132380931 GATGAGGTTGCCTGGGGAGAGGG + Intronic
998422793 5:142003057-142003079 GGTGTGGGTCCAGGAGGAGGTGG - Intronic
998586410 5:143431957-143431979 GATGACTCTCCCTGAGGGGGTGG + Intronic
1001308521 5:170593879-170593901 GAAGAGGATGCCTGAGGTGGTGG + Intronic
1001970756 5:175953295-175953317 TATTAGGGTCACAGAGGAGGAGG - Intronic
1002246682 5:177890470-177890492 TATTAGGGTCACAGAGGAGGAGG + Intergenic
1002423708 5:179163892-179163914 GAGGAGACTCCCTGAGGAGGGGG + Intronic
1002650108 5:180684928-180684950 GAGCAGGGGCCCTGAGGAGGAGG + Intergenic
1002910992 6:1490932-1490954 AATGAGGGTGCCTGAGGAGCTGG - Intergenic
1003568335 6:7239372-7239394 GATCAGGGGCCTTCAGGAGGCGG - Intronic
1005582500 6:27248086-27248108 GATGAGGGAGACTGAGGAGAGGG - Intronic
1006188034 6:32191534-32191556 GGTGAGGGTCTGAGAGGAGGAGG + Intronic
1006370807 6:33642674-33642696 GATGAGGGGCCTGGGGGAGGAGG - Intronic
1007243319 6:40442541-40442563 GCTGGGGCTCCCTGAGGACGGGG + Intronic
1007276769 6:40679809-40679831 GCTGGGGCTCCCTGAGGACGGGG - Intergenic
1007470912 6:42089633-42089655 GGTGAAGGTCCCTGAGGCGTGGG + Intergenic
1007704816 6:43784136-43784158 GAAGAGGCTCCCTGCTGAGGAGG - Intronic
1007729597 6:43937902-43937924 GCTGGGGCTCCCTGAGGATGGGG + Intergenic
1008501652 6:52189345-52189367 GATGAGGGTTCCTGAGGGGCTGG - Exonic
1010042863 6:71407496-71407518 GATGGGGGTCCCAGTGCAGGAGG - Intergenic
1011370561 6:86633129-86633151 GATGGAGGTCCCAGAGGAAGTGG - Intergenic
1011737962 6:90331665-90331687 CATGGGGGTCCCTGAGGTGTGGG - Intergenic
1012944159 6:105448312-105448334 GGGGAGGCTCTCTGAGGAGGGGG - Intergenic
1013051243 6:106537747-106537769 GATGATGGTTCCTGGGGAAGAGG - Intronic
1013100322 6:106980997-106981019 GAGGAGGGCTCCTGATGAGGAGG - Intergenic
1016370238 6:143366151-143366173 GAGGAGAGTCCCTGAGGAGAAGG - Intergenic
1016909491 6:149183542-149183564 GATAAGGGTCCCAGAAAAGGAGG + Intergenic
1018743686 6:166748556-166748578 GAGGTGGGGGCCTGAGGAGGTGG - Intronic
1018743903 6:166749067-166749089 GAGGTGGGGGCCTGAGGAGGTGG - Intronic
1018743960 6:166749211-166749233 GAGGTGGGGGCCTGAGGAGGTGG - Intronic
1018744035 6:166749403-166749425 GAGGTGGGGGCCTGAGGAGGTGG - Intronic
1018856589 6:167679240-167679262 CATGAGGGTGCCTGCAGAGGAGG - Intergenic
1019135410 6:169904741-169904763 GAAGAGGTGCACTGAGGAGGAGG - Intergenic
1019503180 7:1375749-1375771 GAGAAGGGGCCCTGGGGAGGTGG - Intergenic
1019714448 7:2531927-2531949 GAAGAGGGTCCCCACGGAGGGGG + Intergenic
1020116540 7:5479576-5479598 GATGAGGGTCTCAGAGGTGGTGG - Intronic
1020143472 7:5624981-5625003 TTTGTGGGTCACTGAGGAGGGGG - Intronic
1022532699 7:31076807-31076829 GATGGGGGGCCCTGCTGAGGGGG + Intronic
1022835021 7:34105069-34105091 GAGTAGGGTCTCTGGGGAGGAGG + Intronic
1023852547 7:44158479-44158501 GCTGTGGGTCCCTGAGGAAATGG + Intronic
1023965662 7:44962048-44962070 CATGAGGGCCCCTGAGGGGCTGG + Intergenic
1024056583 7:45663399-45663421 GAACAGGGACCCTGAGGAAGAGG - Intronic
1024261702 7:47578427-47578449 AATGAGGGTGACTGAGGATGGGG - Intronic
1024985003 7:55187119-55187141 GATAAGGGACACTGGGGAGGAGG + Intronic
1026315136 7:69221288-69221310 GTTGGGGACCCCTGAGGAGGTGG + Intergenic
1029114790 7:98231531-98231553 AATGGGGGTGCCTGGGGAGGGGG - Intronic
1030291005 7:107872506-107872528 GATGAGTGTCCCCGAGGGTGAGG + Intergenic
1031108029 7:117569598-117569620 TATGAGGGAGCCTGAGGAGAAGG + Intronic
1031587998 7:123555997-123556019 GATGATGGTGACTGAGGAAGAGG + Intronic
1032001467 7:128268135-128268157 GATGAGGGGCATGGAGGAGGGGG - Intergenic
1032975288 7:137215826-137215848 GATGATGGTACCTGAGGGGAGGG + Intergenic
1034518117 7:151597787-151597809 GATGAGTGTTGCTGAGGATGTGG + Intronic
1034541114 7:151758890-151758912 GAAGGAGGTCTCTGAGGAGGCGG + Intronic
1036727854 8:11236066-11236088 AATGAGGGCCCCTGAAGAGGTGG + Intergenic
1036932744 8:12972336-12972358 GAGGAGAGTCCCTGAGGAGTTGG + Intronic
1038328698 8:26591098-26591120 GATGAGGGCACCTGAAGGGGTGG - Intronic
1038644473 8:29350840-29350862 GAGGAGGGGCCCGGAGGGGGCGG - Intergenic
1039410625 8:37352285-37352307 GATGTGGCTCCAGGAGGAGGAGG + Intergenic
1039791406 8:40878797-40878819 GACGATGGGCCCAGAGGAGGGGG - Intronic
1042829268 8:73009036-73009058 GGTGGGGGCCCCCGAGGAGGAGG + Exonic
1049272655 8:141704139-141704161 GATGAGGGTCAGGGAGCAGGAGG - Intergenic
1049310482 8:141931370-141931392 GAGGAGGAGGCCTGAGGAGGAGG + Intergenic
1049623932 8:143611796-143611818 GGAGAGGGACCCTGAGGACGTGG + Intergenic
1052334855 9:27308826-27308848 GTTAAGGGCCCCTGATGAGGAGG + Intergenic
1053391868 9:37741659-37741681 GATGGGGCTCCCAGAGGAGCTGG - Intronic
1055483647 9:76734944-76734966 GAGGAGTGTCCCTGAGGATGAGG + Intronic
1056110273 9:83388330-83388352 GATCAGGGACATTGAGGAGGAGG + Intronic
1056755451 9:89379205-89379227 GGTGATGGCCCCGGAGGAGGTGG + Exonic
1057311749 9:93947538-93947560 GACGAGGGTCCCAGAGGCTGTGG - Intergenic
1060356428 9:122913200-122913222 GTGGAGGGTGCCTGAGGAAGAGG - Intronic
1060545572 9:124457274-124457296 GAAGGGGGTCACTGAGAAGGAGG - Intronic
1061264634 9:129497842-129497864 GAAGAGGGTGCCTGAGGACCAGG + Intergenic
1061296954 9:129682012-129682034 CAGGCTGGTCCCTGAGGAGGAGG + Intronic
1062127552 9:134871660-134871682 GATGTGGGTCTGTGGGGAGGTGG + Intergenic
1062235602 9:135506277-135506299 GATGAGAGTGCCTGAGGCTGGGG + Intergenic
1062236855 9:135514494-135514516 GGAGAGGGTCTCAGAGGAGGGGG + Intergenic
1062554409 9:137107463-137107485 GGTCAGGGTCCATCAGGAGGAGG + Intronic
1185652767 X:1660964-1660986 AAGGAGGGTCACTGAGAAGGGGG + Intergenic
1187447682 X:19373173-19373195 GAGGAGGGGCCAGGAGGAGGAGG + Intronic
1188678223 X:32969107-32969129 GATGAACGTCACTGAGGAAGCGG + Intronic
1191210364 X:57878104-57878126 AAAGAGTGACCCTGAGGAGGAGG - Intergenic
1192163513 X:68807791-68807813 GGAGAAGGTTCCTGAGGAGGTGG + Intergenic
1192347937 X:70327382-70327404 GATCAGGGTCCCAGAGGAAATGG + Intronic
1193359301 X:80561586-80561608 GGTGGGGGTCCCCAAGGAGGGGG - Intergenic
1195079601 X:101358427-101358449 CTTGAGGGTCCCTGAAGAAGTGG + Exonic
1198262186 X:134974663-134974685 AATAAGTGTCCCTGAGGAGGTGG + Intergenic
1201555590 Y:15262394-15262416 GTTGTGGGTTCCTGAGCAGGGGG + Intergenic
1201751419 Y:17436141-17436163 TATGAGTGTCAGTGAGGAGGTGG + Intergenic