ID: 1142413023

View in Genome Browser
Species Human (GRCh38)
Location 16:89925828-89925850
Sequence CACTCTGGGCAGAGGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 338}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142413009_1142413023 25 Left 1142413009 16:89925780-89925802 CCTGTCTGGGGTCCTCGGGCGGT 0: 1
1: 0
2: 0
3: 8
4: 48
Right 1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG 0: 1
1: 0
2: 1
3: 35
4: 338
1142413007_1142413023 26 Left 1142413007 16:89925779-89925801 CCCTGTCTGGGGTCCTCGGGCGG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG 0: 1
1: 0
2: 1
3: 35
4: 338
1142413016_1142413023 1 Left 1142413016 16:89925804-89925826 CCTGGCTGGGCAGGAAGGCCCGT No data
Right 1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG 0: 1
1: 0
2: 1
3: 35
4: 338
1142413013_1142413023 13 Left 1142413013 16:89925792-89925814 CCTCGGGCGGTGCCTGGCTGGGC 0: 1
1: 0
2: 2
3: 25
4: 285
Right 1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG 0: 1
1: 0
2: 1
3: 35
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142413023 Original CRISPR CACTCTGGGCAGAGGGAAGT CGG Intronic
901049054 1:6417141-6417163 CCCTCTGGGCACAGGGAGGTGGG + Exonic
901125358 1:6925098-6925120 CACACTGGGCAGTGGGCAGGGGG + Intronic
901561171 1:10072084-10072106 CCCTCTGGGGAGAGGTGAGTGGG - Exonic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902659244 1:17889976-17889998 CCTTCTGGGCAGAAAGAAGTGGG + Intergenic
903775573 1:25791405-25791427 CACACAGGGCAGAGGGCACTCGG - Intergenic
903968847 1:27106217-27106239 CACTCTGGGCTGAGGGACCCAGG - Intronic
904054036 1:27658691-27658713 CAACGTGGGCAGAGGGAAGGAGG + Intergenic
904163632 1:28538722-28538744 CACTCTGGGCAGAGCAGAGCAGG + Intronic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
905267198 1:36762822-36762844 CATTCTAGGCAGAGGGAACAGGG + Intergenic
905869434 1:41394707-41394729 CCCTCTGGGGAGAGGGTGGTGGG + Intergenic
906191346 1:43901371-43901393 CAGTCTGTCCAGTGGGAAGTAGG - Intronic
906554694 1:46699765-46699787 CACTCTAGGGAAGGGGAAGTAGG - Intronic
906789748 1:48648444-48648466 CTCTCTTGGAAGAGGGAAGTGGG - Intronic
906808557 1:48803365-48803387 CACTGTAGGCAGAGGGAGATTGG - Intronic
907328276 1:53654903-53654925 CAGTCTCTGAAGAGGGAAGTGGG + Intronic
907458678 1:54592527-54592549 AACACTGGGGAGAGGAAAGTAGG - Exonic
907572965 1:55500763-55500785 TAGTCTGGGGAGATGGAAGTTGG + Intergenic
908383867 1:63621909-63621931 CATTCTTGACAGAGGGCAGTTGG + Intronic
910430428 1:87154655-87154677 CAGTCTGGGCAGAGGGGAGTGGG - Intronic
911069422 1:93820758-93820780 ACCTCTGGGAAGAGGGGAGTTGG - Intronic
914835698 1:151205109-151205131 CAAACTGGGGAGAGGGAAGGTGG + Intronic
915524517 1:156467720-156467742 CCCTATGGGGAGAGGGGAGTGGG - Intronic
915590338 1:156866845-156866867 CATTCTGGTCAGAGTGAGGTCGG + Intronic
915755982 1:158260299-158260321 CACTCTGAGCAAGGGTAAGTGGG - Intergenic
915819739 1:159009481-159009503 CACTCTGTGCACAGGAAAGGAGG + Intronic
916498819 1:165369031-165369053 CACCTTGGGCACAGAGAAGTGGG + Intergenic
919255768 1:195122486-195122508 CACTTTGGGGAGAGGGAAATAGG - Intergenic
920044519 1:203124802-203124824 CACTGTGGGCAGAGGTGGGTGGG - Intronic
920250065 1:204617557-204617579 GCCTCTGGGCAGAGAGAAGATGG + Exonic
920738172 1:208554505-208554527 CACTCGGGAAAGAGGAAAGTAGG - Intergenic
921274467 1:213505257-213505279 TACCGTGGGCAGAGGGAGGTGGG + Intergenic
922384034 1:225062676-225062698 CACTCTGAGCAGTGAGAACTTGG - Intronic
922930358 1:229384194-229384216 CACTCTAGCCAGAAGGAAGGAGG - Intergenic
923782259 1:237035656-237035678 CACTATGGGCAGAGCGAAGGAGG - Intergenic
1063331408 10:5163466-5163488 CACACTGGTCACAGGGAGGTAGG - Intergenic
1064065613 10:12178566-12178588 CACTCTGGTCGAGGGGAAGTTGG - Intronic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068008867 10:51422512-51422534 CACACAGGGCAGAGTGAATTTGG + Intronic
1069957587 10:72061416-72061438 CCCTGGGGGCTGAGGGAAGTGGG + Exonic
1070333165 10:75431991-75432013 CGCTAAGGGCAGAAGGAAGTGGG - Intronic
1070713390 10:78699949-78699971 CTCTTTGGGGAGAAGGAAGTTGG - Intergenic
1070916589 10:80158964-80158986 CACTCTGGGCTGAGCGATCTTGG + Intronic
1071541957 10:86493457-86493479 CAATCTAGGCAGAGGGATATGGG + Intronic
1073145999 10:101282401-101282423 GTCTCTGGGCAGAGGGGAATTGG - Intergenic
1073148482 10:101295760-101295782 CACTGAGGGCAAAGGGAAGGAGG - Intergenic
1074619006 10:115098290-115098312 CAGTCAGGGCAGAGGAAAGGAGG - Intronic
1075077928 10:119363682-119363704 GCCTCTGGGAAGAGGGAAGCTGG + Intronic
1075420153 10:122294716-122294738 GCCTCTGGGCTCAGGGAAGTGGG - Intronic
1078050807 11:7963348-7963370 CCCACTGGCCAGAGGGGAGTTGG - Exonic
1078068768 11:8094871-8094893 CACTCTGGGCATAGCTCAGTAGG + Intronic
1078355850 11:10630859-10630881 CACTCTTGGCACAGGGGAGGGGG - Intronic
1078594536 11:12674821-12674843 CTCCCTGGGCCGAGGTAAGTTGG + Exonic
1079136855 11:17780282-17780304 CACCCTGGGCAGAGGCCTGTGGG - Intronic
1079154022 11:17927234-17927256 CACACTGGACAAGGGGAAGTGGG - Intronic
1080604456 11:33853200-33853222 CACTTTGGGCAGAGGGTTGCAGG + Intergenic
1082765915 11:57167573-57167595 AATTCTGGACAGAGGAAAGTGGG - Intergenic
1083202884 11:61131081-61131103 CCCTCTGGCCAGAGGGAAGCGGG - Exonic
1083212990 11:61200683-61200705 CACTCAGGGTAGAGCGTAGTGGG - Intergenic
1083261402 11:61524962-61524984 GACTCAGGGCAGAGGGACATGGG + Intronic
1083265544 11:61545208-61545230 CACTCTTGGCTGATGGACGTAGG - Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1084409220 11:68996855-68996877 CCCTCTGAGCAGTGGGAAGCCGG + Intergenic
1084712386 11:70852057-70852079 CACTCTGTGCCCAGGGAAGCAGG + Intronic
1085885950 11:80521985-80522007 TACTCCAGGCAGAGGGAAATGGG - Intergenic
1086106824 11:83156578-83156600 CCCTCTGGGAACTGGGAAGTGGG - Intergenic
1088988678 11:114931328-114931350 ACCTCTGAGCAGAGAGAAGTAGG + Intergenic
1089399677 11:118157216-118157238 GGCTCTGGGCAGAGGCAGGTAGG + Intergenic
1089612890 11:119679446-119679468 CCAGCTAGGCAGAGGGAAGTGGG + Intronic
1089637686 11:119826650-119826672 CACTCTAGGAAGAGGTAATTTGG + Intergenic
1090185154 11:124734042-124734064 ACCTCTGGGCAGAAGGAAGGGGG - Intergenic
1091314089 11:134598555-134598577 TGCTCTGGGCAGCAGGAAGTTGG + Intergenic
1091770796 12:3150018-3150040 AGCTCTGGGCAGAGGGGTGTGGG + Intronic
1091936553 12:4439484-4439506 CATTCTAGGCACGGGGAAGTGGG - Intronic
1094046106 12:26168641-26168663 CATTCTGGGCAGCAGGAAGAAGG + Intronic
1094063627 12:26340833-26340855 CACTTGAGGAAGAGGGAAGTGGG + Intronic
1096511719 12:52133678-52133700 CACTCTTGGCTGAGGGTGGTGGG - Intergenic
1096967329 12:55638648-55638670 GTCCCTGGGCTGAGGGAAGTGGG - Intergenic
1096985087 12:55750883-55750905 CTCTCTTGGCTGAGGGAATTTGG - Exonic
1097853532 12:64437449-64437471 CATTCTGGGCAAAGTTAAGTAGG + Intronic
1098574730 12:72028320-72028342 CACTCTGGACATAGAGAAGAGGG + Intronic
1098825725 12:75294959-75294981 CTCACTGGGGAGAGGGAAATGGG + Intronic
1100107486 12:91193668-91193690 CAGGCTATGCAGAGGGAAGTGGG - Intergenic
1101338929 12:103823943-103823965 CTGACTGGGCAGAAGGAAGTTGG - Intronic
1102494786 12:113312051-113312073 CTCTGTGGGAAGAGGGGAGTTGG + Intronic
1102513242 12:113429480-113429502 CAGGGTGGGCAGAGGAAAGTTGG - Intronic
1102576904 12:113861357-113861379 CAGTGTGGGCAGAAGGAACTGGG - Intronic
1103209795 12:119157785-119157807 CAGCCTGGGCAGAGGGGAGGGGG - Exonic
1103262558 12:119600777-119600799 GACTATGGGGAGAGGGAAATGGG + Intronic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1105024993 12:132842250-132842272 CAGTCTGTGGAGAGGGAAGGTGG - Intronic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1106394081 13:29363487-29363509 CACTCTGAGAAGAAGGAGGTTGG - Intronic
1107076255 13:36324145-36324167 CATTCTTCCCAGAGGGAAGTGGG + Intronic
1107713503 13:43174166-43174188 AACTATGGGGAGAGGGAAGTAGG - Intergenic
1109658825 13:65431428-65431450 TACTGGGGGCAGAGGGAGGTGGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111442815 13:88303363-88303385 CGCTCAGAGCAGAAGGAAGTGGG - Intergenic
1111549556 13:89788971-89788993 AGCTCTGCTCAGAGGGAAGTTGG + Intergenic
1112433130 13:99370564-99370586 CACTCTGGGGACAGGGAATGGGG - Intronic
1113595817 13:111531003-111531025 GTCCCTGGGCAGAGGGAAGCAGG - Intergenic
1114080910 14:19200887-19200909 CACTCTGGACACAGTGCAGTGGG - Intergenic
1114463493 14:22903582-22903604 CCCACAGGGCAGAGGGCAGTAGG - Intronic
1117414334 14:55479881-55479903 CACTTTGGCCAGCGGAAAGTTGG + Intergenic
1118346712 14:64946383-64946405 CACACTGGGGCTAGGGAAGTAGG - Exonic
1119415739 14:74468051-74468073 CTCCCTGTGCAGAGGGAAGCTGG + Intergenic
1119651747 14:76388818-76388840 CAAGCTGAGAAGAGGGAAGTCGG - Intronic
1121051832 14:90824274-90824296 CATTCTGGGCAGGGGGAGATAGG - Intergenic
1121680850 14:95791662-95791684 CACACTGAGGAGAGGGGAGTGGG - Intergenic
1124477242 15:30045463-30045485 CCCTCTGGGCACAGGCACGTGGG - Intergenic
1127285228 15:57526868-57526890 CACGCTGGGCATTGGGAAGGGGG + Intronic
1128894645 15:71361255-71361277 GAATCTGGGCACAGAGAAGTAGG - Intronic
1129144391 15:73633589-73633611 CTCTCTGGGCAGTGGGGAGCTGG + Intronic
1129155487 15:73714684-73714706 CCCTCTGGGTAAAGTGAAGTTGG + Intergenic
1129296819 15:74604335-74604357 CCCTGTGGGCAGAGGGGAGGTGG + Intronic
1129935865 15:79449864-79449886 TACTCTAGGCAGAGGGCAGAAGG - Intronic
1130090883 15:80820245-80820267 CAGACTGGTCAGAGGAAAGTGGG + Intronic
1130304095 15:82701193-82701215 AACTCTGCCCAGAGGGAAGAGGG - Intronic
1130407741 15:83617322-83617344 AGCTCTGGGGAGAGGGTAGTAGG - Intronic
1130731195 15:86493853-86493875 CAGTCAGGGGAGGGGGAAGTGGG - Intronic
1132618727 16:854589-854611 CAGGCTGAGCGGAGGGAAGTAGG + Exonic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134313974 16:13101110-13101132 GGCTGTGGGGAGAGGGAAGTGGG + Intronic
1134562016 16:15219043-15219065 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1134922554 16:18130669-18130691 CACCCTGAGGAGGGGGAAGTGGG - Intergenic
1135705183 16:24668876-24668898 CACTCTGTTCAAAGGGAGGTTGG - Intergenic
1136298956 16:29320572-29320594 AGTTCAGGGCAGAGGGAAGTTGG + Intergenic
1137043939 16:35639155-35639177 GACTCTGGGCAGAGAGAAGGAGG + Intergenic
1137572820 16:49577971-49577993 CACTGTGGGCAGGTGGAAGAAGG + Intronic
1138147313 16:54624360-54624382 GGCTTTTGGCAGAGGGAAGTAGG + Intergenic
1138713670 16:58997613-58997635 CAGTCAGGGCAGAGGGGACTTGG + Intergenic
1138716274 16:59026559-59026581 AACTCAGGGGAGAGGGAAATGGG + Intergenic
1138984081 16:62305620-62305642 GACTGTGGGCAGAGGGAATGGGG + Intergenic
1139201635 16:64983634-64983656 GACTCTGGGAAGATGGAGGTGGG - Intronic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1140851872 16:78942509-78942531 CTCTCTGGGCAGTGGGATGGGGG + Intronic
1142060641 16:88027127-88027149 AGCTCAGGGCAGAGGGAAGTTGG + Intronic
1142120451 16:88383996-88384018 CACCCTGGGCCGAGGGCAGAGGG + Intergenic
1142238516 16:88934532-88934554 CACACTGTGCACAGGGAAGATGG - Intronic
1142413023 16:89925828-89925850 CACTCTGGGCAGAGGGAAGTCGG + Intronic
1142899737 17:3004538-3004560 ACCTCTGTGCAGAGGGAAGGCGG + Intronic
1142979099 17:3661377-3661399 AGCTTTGGGCAGAGGGAAGGAGG - Exonic
1143253516 17:5539375-5539397 CCTTCTGGGCAGAGGGAAGAGGG - Intronic
1143375729 17:6466000-6466022 GACTCTACGCAGAGGGCAGTGGG - Intronic
1143480454 17:7224938-7224960 CAGCCTGGGGAGAGGGAAGGAGG - Exonic
1143554710 17:7652759-7652781 CACCCTGGGCAGAGGCAGGGAGG - Intronic
1147321912 17:39651811-39651833 CACTCTGGGAGGCGGGAGGTGGG - Intronic
1148243089 17:46012781-46012803 CACCCAGGCCAGAGGGAAGAGGG + Intronic
1148336969 17:46848452-46848474 CCCACAGGGCAGAGGGAAGGTGG + Intronic
1148673572 17:49431755-49431777 CACTTTGGGCAGGTGGAGGTGGG - Intronic
1149567172 17:57648634-57648656 CACTCTGGGCAGTGGGGTGCTGG + Intronic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150707410 17:67499579-67499601 GCCTCTGGGCAGTAGGAAGTAGG - Intronic
1152217828 17:79044734-79044756 CACTCTGGGTACATGGCAGTTGG - Intronic
1152496654 17:80677573-80677595 CAGTCTGGTGAGAGGGAAGGTGG - Intronic
1153255463 18:3165981-3166003 CACAGTGGGCAGTGGGTAGTAGG - Intronic
1153729822 18:7999510-7999532 TTCTCTGAGCAGAGGCAAGTGGG + Intronic
1153820643 18:8828664-8828686 CTCTCTGGGCAGATGGCAGAGGG + Intronic
1154326189 18:13392488-13392510 TCCTCTGAGCAGAGGGAAGCAGG + Intronic
1154499511 18:14988234-14988256 CACTCTGGACACAGTGCAGTGGG + Intergenic
1155046752 18:22109633-22109655 CACCCTGGGGAGATGGGAGTAGG + Intergenic
1155911908 18:31513690-31513712 TCCTCAGGGCAGAGGGAAGCGGG - Intronic
1156514563 18:37669209-37669231 CAGAAAGGGCAGAGGGAAGTGGG - Intergenic
1157402008 18:47396475-47396497 CACTATGAGGGGAGGGAAGTAGG + Intergenic
1157680147 18:49598763-49598785 CAACCTGGGGAGAGGGCAGTGGG - Exonic
1157934714 18:51860040-51860062 CACGCTGGGCAGAAAGAAGTGGG - Intergenic
1159002472 18:62986694-62986716 CACCCTGGGCAGAGTGCAGTGGG + Intergenic
1159424904 18:68272518-68272540 CACTCTTGGGAGGGGGAAGGGGG - Intergenic
1160434257 18:78833250-78833272 CTACCTGGCCAGAGGGAAGTGGG + Intergenic
1161614260 19:5261170-5261192 CCCTCTGGGCTGAGGGAGGGAGG + Intronic
1161835775 19:6645303-6645325 CACCCTGGGGACAGGGAAGCCGG + Intergenic
1162188750 19:8927931-8927953 CACTCTGGGCTGAGAGATGGAGG - Intronic
1163646785 19:18494071-18494093 CACTCTGGGCAGTGGAGAGGAGG - Intronic
1164428807 19:28168898-28168920 CACTCTGACCAGGGGGATGTTGG - Intergenic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1166270163 19:41708616-41708638 GACTCAGGGCAGAGGGAGGAAGG + Exonic
1167301790 19:48681933-48681955 CACCCTGGGCGCAGGGAAGAAGG + Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168335855 19:55597479-55597501 TACTCTGGGCAAAAGGAAGCTGG - Intronic
1168507090 19:56945401-56945423 CACTCTGGCTACAGGGAAGGAGG + Intergenic
925061456 2:893964-893986 CACTCCAGTCAGAGGGAAGTGGG + Intergenic
927119179 2:19938675-19938697 CAATCTGAGCAGAGGGAAACAGG - Intronic
929486086 2:42356134-42356156 CATTCTAGGCAGAGGGAACATGG - Intronic
931514832 2:63044110-63044132 CAGTCTGGCCAGAGAGCAGTTGG + Intronic
931901317 2:66791540-66791562 CACTGAATGCAGAGGGAAGTTGG + Intergenic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
933708032 2:85305862-85305884 CACTCTGGGCAGAACCAAGTTGG - Intronic
935274566 2:101464916-101464938 CACCCTTATCAGAGGGAAGTGGG - Intronic
937354956 2:121192481-121192503 GACTTGGGGCAGAGGGGAGTGGG - Intergenic
937631425 2:124106412-124106434 ACCTCTGGGCAGAGGAAAGAGGG + Intronic
938341337 2:130538532-130538554 CACCATGGGCAGAGGGAAAGTGG + Intergenic
938348494 2:130582177-130582199 CACCATGGGCAGAGGGAAAGTGG - Intronic
938498717 2:131818602-131818624 CACTCTGGACACAGTGCAGTGGG + Intergenic
938515923 2:132007370-132007392 CTCTCAGGGCATAGGGAGGTTGG - Intergenic
940908170 2:159187094-159187116 CACCCAGGGCAGAGGGAAACAGG - Intronic
943266275 2:185737317-185737339 CACTTTGCGCTGAGGGCAGTTGG + Intergenic
945874942 2:215268127-215268149 CCCTCAGGTCAGAGGGAAGCTGG - Intergenic
947588843 2:231373093-231373115 CACTCTGTGCTCAGGGAAGAAGG + Intronic
947889282 2:233602813-233602835 CTTTCTGGGCAGAGGGCATTTGG + Intergenic
948125704 2:235563425-235563447 CTGCCTGGGCAGAGGAAAGTGGG - Intronic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1168932598 20:1636119-1636141 CAGCCTGGGGAGAGGGGAGTGGG + Intronic
1170828406 20:19817577-19817599 GACTCTAAGGAGAGGGAAGTGGG + Intergenic
1170940755 20:20846096-20846118 CACTCTGGGCACTGGGCACTGGG + Intergenic
1172107436 20:32525060-32525082 CAGGCTGGGCAGCGGGAAGTGGG + Intronic
1172384144 20:34521694-34521716 CACTCTGGGCAATGGGATGATGG - Intronic
1172935780 20:38619142-38619164 CATTCCAGGCAGAGGGAAGAAGG + Intronic
1172957447 20:38771173-38771195 CACTCTGAGTAGAGGGAAACAGG - Intronic
1173709145 20:45139226-45139248 CACACTGGGACGAGGGGAGTTGG - Intergenic
1173718126 20:45229464-45229486 CACAGTGGGAAGAGGGAAATTGG + Intergenic
1174144346 20:48440666-48440688 CACTCTGGCCAAGGAGAAGTGGG + Intergenic
1174400251 20:50272157-50272179 TTCTCTGAGCAGAAGGAAGTGGG - Intergenic
1175169953 20:57073226-57073248 CACCCAGGGCAGAAGGAGGTGGG + Intergenic
1175697694 20:61114882-61114904 CACTGTGGGCAGTGGGCAGTGGG + Intergenic
1175781581 20:61685659-61685681 CACTCTGTGCAAAGGGGTGTGGG - Intronic
1176067573 20:63206485-63206507 CACCTTGGGTAGAGGGAAGCTGG - Intronic
1178743660 21:35226795-35226817 CACTCCAGGCAGAGGGAATTTGG - Intronic
1178958548 21:37044077-37044099 CACTCAGGACAGAGAGCAGTGGG - Intergenic
1179099895 21:38347297-38347319 CACTTTGGCCACAGGGATGTGGG + Intergenic
1179399408 21:41070110-41070132 CACTCTGGGGAGAGTGAGGAGGG - Intergenic
1180499862 22:15921798-15921820 CACTCTGGACACAGTGCAGTGGG + Intergenic
1181948239 22:26535530-26535552 CACTTTGGGAAGAGTGAAGCAGG + Intronic
1182129620 22:27841330-27841352 CAGGCTGGGCAGTGGGAACTGGG - Intergenic
1182274517 22:29177924-29177946 TTCTCTGGGCAGAGGGTAGGTGG + Intergenic
1182279813 22:29211754-29211776 CAATCTGGGCAGAGGACAGTCGG - Intronic
1183444523 22:37844296-37844318 GACTCAGGGCGGAGGGAAGTAGG - Exonic
1183697637 22:39432193-39432215 CACTCTCAGCAGAGTGGAGTTGG - Intronic
1184409061 22:44316189-44316211 CACCCTGGGGAGAGGGACCTGGG + Intergenic
1184931190 22:47682458-47682480 CCCTCAGGGCAGGGGGAAGGCGG - Intergenic
1185161664 22:49233666-49233688 TCCTCTGAGCAGAGGGAGGTGGG + Intergenic
949642516 3:6054209-6054231 CACAATGGGCAAAGAGAAGTAGG - Intergenic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
950638740 3:14334183-14334205 CACTCTGGGCAGAGGGGGCTGGG - Intergenic
950692350 3:14669983-14670005 TACTCTGGGCAGCAGGACGTGGG - Exonic
951516496 3:23565634-23565656 CCCTCTGGCTAAAGGGAAGTTGG + Intronic
951764760 3:26185349-26185371 CCCTCAGGGCAGAAGGAAGAAGG - Intergenic
952128022 3:30324889-30324911 CTCTCTGGGCAGAGGTAGGGAGG + Intergenic
952305407 3:32141740-32141762 CCCTCTGGGAAGAGGGAAATGGG - Intronic
952519786 3:34145207-34145229 CACTCTGAGAAGAGGGACTTGGG + Intergenic
953187605 3:40653141-40653163 CACACTGGGCTGAGGGCAGATGG + Intergenic
953249086 3:41226944-41226966 CACTGTGGGAAGAAGGAAATTGG + Intronic
954041485 3:47891251-47891273 AACTCTGGGAAGAAGGAACTCGG - Intronic
954665462 3:52249087-52249109 CTTTCTGGGCAGATGGAAGCTGG - Intronic
956114491 3:65904590-65904612 CATTCTGGGCTGAGGGATGGTGG - Intronic
956576682 3:70759987-70760009 CACTCCTGCCAGAGGGCAGTTGG - Intergenic
958188369 3:90152621-90152643 CCATCTGGACAGAGGGAATTTGG + Intergenic
958410893 3:93814455-93814477 CCATCTGGACAGAGGGAATTTGG + Intergenic
959370394 3:105517372-105517394 CACACTAGACAGAGGGCAGTAGG - Intronic
966008650 3:175049270-175049292 CACACTGGGTAAATGGAAGTGGG + Intronic
967891446 3:194367038-194367060 CATGCTGGGCAGGGGGAAGGTGG - Intronic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968648371 4:1750782-1750804 CACTGTGGGCACAGGGGGGTCGG - Intergenic
968952536 4:3702392-3702414 CAGTCTGGGCAGTGGGAGGGGGG - Intergenic
969066122 4:4482693-4482715 CATTCTGGGCAGAGAGAAGCAGG - Intronic
969846365 4:9923174-9923196 CACTCTGGGCAGGAGGCAGAAGG + Intronic
975698143 4:77034807-77034829 CGCTTTGGACAGAGGAAAGTGGG + Exonic
975837776 4:78442476-78442498 CACCCTGGGCAGAGGGAAAGTGG + Intronic
976085207 4:81400806-81400828 CACTGCAGGCAAAGGGAAGTGGG + Intergenic
977115279 4:93016551-93016573 CTCTCTGGGCAGTTGGAAGTGGG + Intronic
978305684 4:107325862-107325884 TACTTTGGACAGAGGGAAGAGGG + Intergenic
978387694 4:108192309-108192331 CCCTCTGGGCAGAGGGAATCAGG + Intergenic
978921206 4:114184576-114184598 CATTCCAGGCAGAGGAAAGTAGG - Intergenic
980854353 4:138421532-138421554 GACTTTATGCAGAGGGAAGTGGG + Intergenic
983417103 4:167471309-167471331 CACTCAGGGCAGTGGGAGCTGGG + Intergenic
984843727 4:184092415-184092437 CACTCTGGGCAGAGGCACAGTGG - Intronic
985081117 4:186265043-186265065 CCCACTGGACAGTGGGAAGTGGG - Intergenic
986162197 5:5240216-5240238 CACTCTTGGGGGAGGGAGGTGGG + Intronic
986239872 5:5951406-5951428 CACACTGGGCTGAGGGTTGTTGG + Intergenic
986253214 5:6080147-6080169 CACTCCAGGCAGAAGGAGGTGGG + Intergenic
990172026 5:53062200-53062222 TTTTCTAGGCAGAGGGAAGTGGG - Intronic
991166217 5:63567325-63567347 CATTTTGGGTAGAGGGAAGGAGG - Intergenic
992661319 5:78963821-78963843 CACTTTGGGCAGGGGGGAGCTGG + Intronic
993605637 5:89987557-89987579 CACCTTGGGCAGAGGGCAGAGGG + Intergenic
993959420 5:94278634-94278656 CACTGTGGGCACAGGAAATTAGG + Intronic
994267094 5:97730405-97730427 CACTCTGGGAAGTGGGAGATAGG + Intergenic
994286133 5:97970604-97970626 CACTCTTGACAGAGGGACCTAGG - Intergenic
994677087 5:102837049-102837071 AACTCTGGGCAGATGGAAAGTGG - Intronic
996523320 5:124451053-124451075 CACTCTGGACAAAGGGAACAAGG - Intergenic
996699395 5:126435168-126435190 CAGTCTGGGGAGAGGGGAATGGG + Intronic
999287128 5:150400822-150400844 GGCTCTGGGCCCAGGGAAGTGGG - Intergenic
999975180 5:156905204-156905226 CACTCAGGACAGAGTGCAGTGGG + Intergenic
1000352276 5:160361283-160361305 CAGTCTGGGCAGAGGGCCCTTGG - Intronic
1000435892 5:161208467-161208489 CACTTTGGGAAGACTGAAGTGGG + Intergenic
1001174026 5:169448219-169448241 CACACTGGGGAGGGAGAAGTGGG - Intergenic
1001199112 5:169699773-169699795 CACTTTGGGCTTAGAGAAGTGGG + Intronic
1001396726 5:171423216-171423238 CACCCTGGGAAGTGGGAAGCTGG + Intronic
1001978871 5:176023876-176023898 CACTCTGAGCTGGGGGAAGGAGG - Intronic
1002238544 5:177819890-177819912 CACTCTGAGCTGGGGGAAGGAGG + Intergenic
1003078604 6:3003235-3003257 CACACTTGGCAGTGAGAAGTGGG - Intronic
1003084735 6:3052495-3052517 CACACTTGGCAGTGAGAAGTGGG + Intergenic
1004304928 6:14491757-14491779 GATGCTGGGCACAGGGAAGTTGG - Intergenic
1004750924 6:18561130-18561152 CCATCTGGGCAGAGGGAATGTGG - Intergenic
1004788326 6:18994529-18994551 CACTCTGGTCCGAGGAATGTTGG - Intergenic
1005993322 6:30916864-30916886 CTCTCTGGGCACAGGAAAGGTGG + Exonic
1006109297 6:31735101-31735123 CTCCCTGGGCCCAGGGAAGTCGG - Intronic
1006140043 6:31923043-31923065 CACTCCAGGTAGAGGGAAGCAGG - Intronic
1006941614 6:37755426-37755448 GTCTCTGGGCAGAGGCAAGGAGG + Intergenic
1007264046 6:40584145-40584167 CTCCCTGGACAGGGGGAAGTTGG + Intronic
1007358164 6:41335692-41335714 TTCTGTGGGCACAGGGAAGTGGG - Intronic
1008569921 6:52806619-52806641 CACCTTCAGCAGAGGGAAGTTGG + Intergenic
1008579961 6:52897822-52897844 CACCTTCAGCAGAGGGAAGTTGG + Exonic
1010811141 6:80300078-80300100 CAGTCTGGGCAGTGGGAATATGG - Intronic
1011223651 6:85084219-85084241 CACTCTGGGGTCAGGGATGTCGG - Intergenic
1012155404 6:95813339-95813361 CACACTGGCCAGGTGGAAGTGGG + Intergenic
1013246796 6:108294799-108294821 CAGTCTGGGCAGTGGGAGGGAGG - Intergenic
1013270118 6:108537498-108537520 CATTCTAGTCAGAGGGAAGCTGG + Intergenic
1014266043 6:119278860-119278882 CACTCATGGCAGAAGGCAGTGGG - Intronic
1016471574 6:144380365-144380387 ATCTCTGGGCAGAGGGAAAATGG + Intronic
1016793707 6:148094983-148095005 CACTATGGGGGTAGGGAAGTTGG + Intergenic
1016839455 6:148511673-148511695 GAATCTGGGCAGAGGAAAGTAGG + Intronic
1017073706 6:150599749-150599771 CCCTCAGGGCAGAGGGGAGGCGG + Intergenic
1017261175 6:152389565-152389587 TACTCTGAGAAGAGGGAGGTAGG + Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1019020547 6:168914164-168914186 AAGTCTGGGCAGATGGAAGCAGG + Intergenic
1019200864 6:170313922-170313944 CACTCTGGACACAGGGATGAGGG - Intronic
1019405794 7:883352-883374 CTCTCTTGGCAGACGGAAGCTGG - Intronic
1020553241 7:9634943-9634965 TACTCTGGGCAGAAGAAGGTGGG - Intergenic
1022337129 7:29432431-29432453 AATTATGGGGAGAGGGAAGTGGG - Intronic
1026342372 7:69445530-69445552 GAGTCTGGGCAGATAGAAGTTGG - Intergenic
1026464508 7:70642613-70642635 CAGTATGGACACAGGGAAGTAGG - Intronic
1026982797 7:74536424-74536446 TTCTCTAGGCAGAGGGAAGTAGG - Intronic
1028616255 7:92770845-92770867 AACACTGGGTAGAGGAAAGTGGG + Intronic
1029371890 7:100155557-100155579 AAAGCTGGGCAGAGGGAAGGTGG - Intronic
1032135933 7:129277688-129277710 CTCTTTGGGGAGAGGGGAGTGGG + Intronic
1032789676 7:135233180-135233202 CACTCTGGGTAGTAGGAAGTAGG - Intronic
1033151309 7:138917040-138917062 CTCTGTGGGCAGAGGGAAGGGGG + Exonic
1033380423 7:140811432-140811454 CTCTCAGGGGAGAGGGGAGTAGG + Intronic
1033808700 7:144984194-144984216 GACTCAAGGAAGAGGGAAGTGGG - Intergenic
1034272525 7:149810190-149810212 CACTCTAGTCAGAGGGTGGTAGG + Intergenic
1035894690 8:3386343-3386365 CACTCTGGGCAGGAGTAGGTGGG - Intronic
1037116538 8:15236104-15236126 TTCCCTGGGCAAAGGGAAGTAGG - Intronic
1038577742 8:28719488-28719510 CACTTTGCACAGAAGGAAGTAGG - Intronic
1040384256 8:46902984-46903006 CACTGGGGACAGAGGGAAGAGGG + Intergenic
1040545776 8:48396947-48396969 GACTCCAGGCAGAGGGATGTGGG - Intergenic
1041574599 8:59379898-59379920 CATTTTGGAAAGAGGGAAGTTGG + Intergenic
1044813692 8:96089394-96089416 TCCTATGGGCAGAGGGAAGTGGG - Intergenic
1045726372 8:105178536-105178558 GTCTGTGGGCAGAGAGAAGTTGG + Intronic
1045980519 8:108181713-108181735 CACCCTGGCCAGAGTGCAGTGGG + Intergenic
1048991051 8:139760333-139760355 CACCCTGGGGAGTGGGAACTGGG + Intronic
1049391481 8:142373782-142373804 CACTCCAGGCAGAGGCAAGCAGG + Intronic
1050296137 9:4207239-4207261 CACACTATGCAGAGGGAAGGTGG + Intronic
1050775684 9:9257224-9257246 AACTCTGAGCAGAAGGAAGGAGG + Intronic
1053273454 9:36766055-36766077 GACTCTGGGCGGGAGGAAGTGGG + Intergenic
1054809893 9:69426354-69426376 CAGTCTGGGGATGGGGAAGTAGG + Intergenic
1054833269 9:69649416-69649438 GACTCTGGGCAGAAGGGAGAGGG - Intronic
1055131938 9:72785705-72785727 CATCCTGGGCAGGGTGAAGTGGG + Intronic
1055231282 9:74069653-74069675 GGCTCTGGGGAGAGGGAAATGGG - Intergenic
1055592787 9:77835114-77835136 CACCCTGGGCAGGGTGAGGTGGG + Intronic
1059368629 9:113807173-113807195 TAGACTGGTCAGAGGGAAGTGGG - Intergenic
1059545380 9:115170768-115170790 TACTCCAGGCAGAGGGAAGGTGG - Intronic
1060026008 9:120172110-120172132 CACTCTGGGCAGTGTGGAGGGGG - Intergenic
1060689016 9:125639576-125639598 CACTATGTACACAGGGAAGTGGG + Intronic
1061222852 9:129262287-129262309 CTCTCTGGGCAGAGGGGTCTGGG + Intergenic
1062003743 9:134229239-134229261 CACTGTGGGCTGAGGGACGGAGG + Intergenic
1062561276 9:137143181-137143203 GACTCTGGGCAGGAGGAATTTGG - Intronic
1186462053 X:9755617-9755639 CATTCTGGGCATCAGGAAGTGGG - Intronic
1188169686 X:26909780-26909802 CACTCTTTTCAGAGGCAAGTGGG + Intergenic
1189252589 X:39612990-39613012 CACTCTGGGGAGTGGGACGTGGG - Intergenic
1189308799 X:40006115-40006137 GCCTGGGGGCAGAGGGAAGTGGG + Intergenic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1189992642 X:46609269-46609291 CACTCTTTGCAGAGGGAAGCAGG + Intronic
1190573614 X:51810662-51810684 TACTCTGGGCATAGGCAAATGGG + Intronic
1191952552 X:66608841-66608863 CACTTTGGGGAGGGGGAAATTGG + Intronic
1192112180 X:68376375-68376397 CACTTCAGGCAGATGGAAGTAGG + Intronic
1195670021 X:107461859-107461881 GAGTCTGGGCATTGGGAAGTGGG - Intergenic
1197915992 X:131536034-131536056 CACTGTGGGCAAAGGGAAAGTGG - Intergenic
1198401069 X:136268844-136268866 TACTCTGGGCAGTGTTAAGTAGG + Intergenic
1199599359 X:149532771-149532793 CACTCTGGGCAGGGGGCTGGGGG - Intronic
1200152440 X:153957859-153957881 CAATCTGGGCAAAGTGATGTCGG - Exonic
1200225210 X:154413292-154413314 AAATCTGGGCAGAGGCAGGTGGG - Intronic
1200397400 X:155999233-155999255 TACCCAGGGCAGAGGGGAGTAGG - Intronic
1201575057 Y:15454639-15454661 CTCACTGGGCAGGGGGAAGGTGG + Intergenic
1201578442 Y:15485724-15485746 CACTTTGGGCTGGGGGCAGTGGG + Intergenic