ID: 1142413124

View in Genome Browser
Species Human (GRCh38)
Location 16:89926169-89926191
Sequence GGCGAACCCCGCCCCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 102}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142413124_1142413132 -8 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413132 16:89926184-89926206 GGTTCGCCTGCAGCGGCGGAGGG 0: 1
1: 0
2: 0
3: 3
4: 58
1142413124_1142413140 22 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413140 16:89926214-89926236 TTTGTCCTCCGCGCGGGCTGCGG 0: 1
1: 0
2: 0
3: 6
4: 55
1142413124_1142413131 -9 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413131 16:89926183-89926205 GGGTTCGCCTGCAGCGGCGGAGG 0: 1
1: 0
2: 1
3: 12
4: 137
1142413124_1142413138 16 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413138 16:89926208-89926230 GGAGCCTTTGTCCTCCGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 74
1142413124_1142413133 -7 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413133 16:89926185-89926207 GTTCGCCTGCAGCGGCGGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 50
1142413124_1142413137 15 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413137 16:89926207-89926229 GGGAGCCTTTGTCCTCCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 85
1142413124_1142413135 -5 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413135 16:89926187-89926209 TCGCCTGCAGCGGCGGAGGGGGG 0: 1
1: 0
2: 0
3: 12
4: 172
1142413124_1142413134 -6 Left 1142413124 16:89926169-89926191 CCCTCCCCGGGGCGGGGTTCGCC 0: 1
1: 0
2: 0
3: 6
4: 102
Right 1142413134 16:89926186-89926208 TTCGCCTGCAGCGGCGGAGGGGG 0: 1
1: 0
2: 0
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142413124 Original CRISPR GGCGAACCCCGCCCCGGGGA GGG (reversed) Intronic
900114030 1:1020948-1020970 GGGGCTCCCCACCCCGGGGAGGG + Intronic
900290944 1:1923345-1923367 GGTGAGCCCCTCCCCAGGGAGGG - Exonic
900314700 1:2050896-2050918 GGGAAACCCGGTCCCGGGGAAGG - Intronic
900786332 1:4653005-4653027 TGCAAACACCTCCCCGGGGAGGG + Intergenic
903813260 1:26046377-26046399 GGCGCACCCCGCGCGGGAGAGGG - Intergenic
903860193 1:26360298-26360320 GGAGAACCACGCCCCCGGGGTGG - Intergenic
907091498 1:51729771-51729793 GGCGACCCCTCCGCCGGGGAGGG + Intronic
915901972 1:159854249-159854271 GGCGAACCCTGCCCAGGGCCGGG - Intronic
916566916 1:165988672-165988694 GGCTGACCCCGTCCCGGAGATGG + Intergenic
1064028797 10:11869982-11870004 GGCGTCCCCCGCGGCGGGGAAGG - Exonic
1075608932 10:123836121-123836143 GGAGATCCCCGCAACGGGGATGG + Intronic
1076535329 10:131173546-131173568 AGGGAACCCTGCCCCTGGGAAGG + Intronic
1076792489 10:132784724-132784746 GGCGAAGCCGGGGCCGGGGAGGG + Intergenic
1077535536 11:3122326-3122348 GGTGAGCCCGGGCCCGGGGAGGG - Exonic
1077544888 11:3165021-3165043 GGGGAACCACGCCGCGGGGCCGG - Intronic
1078514364 11:12009398-12009420 GGCCCACCCCGCCCCGCGGAGGG + Intronic
1078901934 11:15650275-15650297 GGAGAACCGCGCCCCCGGGGTGG + Intergenic
1082238935 11:49852189-49852211 TGCCGACCCCGCCCCGCGGAAGG + Intergenic
1082243207 11:49892141-49892163 TGCCGACCCCGCCCCGCGGAAGG - Intergenic
1083751866 11:64765493-64765515 GGCCATCGCCGCCGCGGGGAGGG + Exonic
1085767438 11:79295433-79295455 AGTGACCCCCGCCCCGGGAAAGG + Intronic
1089672059 11:120063379-120063401 GGCTAATCCCTCCCTGGGGAGGG - Intergenic
1103742302 12:123099109-123099131 GGGGAACTCAGCCCCTGGGATGG - Intronic
1113753309 13:112791370-112791392 GGCGAGCTCCGCCCCAGGAAGGG - Intronic
1119338099 14:73851782-73851804 TCCAAACCCCGCCCCTGGGAGGG + Intergenic
1121466258 14:94117125-94117147 TGCGCACCCTGCCCTGGGGAGGG + Intergenic
1121710982 14:96039232-96039254 GACGGACCCCGCCCCGGGGGTGG + Intergenic
1123008294 14:105334919-105334941 GGGGAACCCCACCCCATGGAGGG - Intronic
1132407767 15:101554670-101554692 CTGGAACCCCGCCCCGGGAAGGG + Intergenic
1133784176 16:8962792-8962814 GGCGAGCCCCGCGCCCGGGGAGG + Intronic
1137787992 16:51152643-51152665 TGGGCACCCCGCCCTGGGGAGGG + Intergenic
1139751163 16:69109633-69109655 ACCGAGCCCCGCCGCGGGGAGGG - Exonic
1140954394 16:79848950-79848972 GGCCAACCACGCCCCAGGAATGG + Intergenic
1142413124 16:89926169-89926191 GGCGAACCCCGCCCCGGGGAGGG - Intronic
1145012644 17:19378560-19378582 GGAGACCCCCGCGCTGGGGACGG + Intronic
1146132661 17:30292059-30292081 GGCTGGCCCCGCCCGGGGGAGGG + Intergenic
1147900130 17:43778563-43778585 CGTGCACCCCGCCACGGGGAAGG + Intronic
1160905472 19:1449933-1449955 GGCGAAACCCCCCCGAGGGAAGG - Intronic
1161153376 19:2720901-2720923 GGAGGAGCCCACCCCGGGGAGGG + Intronic
1161203601 19:3029097-3029119 CGCGCACCCCAACCCGGGGAGGG - Exonic
1163118356 19:15201032-15201054 GGCTCGCCCCGCCCCGGGGCCGG + Intergenic
1163410246 19:17149542-17149564 GGCCATCCTCGCCCCAGGGAGGG + Intronic
1163760666 19:19134762-19134784 GGTGAGCCCCGCCCCGGCGGTGG - Exonic
1165851054 19:38850540-38850562 GGGGAGCCCCGCCCCAGGGTAGG + Intronic
1165922412 19:39307436-39307458 CCCGAACCCCGCCCTGGGCACGG + Exonic
1167293208 19:48635660-48635682 CACGAACCCGGCCCTGGGGAGGG + Exonic
1168155398 19:54471419-54471441 GGAGACCCCCGGCCCGGCGAGGG + Intronic
925918627 2:8624574-8624596 GCTGAACACAGCCCCGGGGAAGG + Intergenic
930136335 2:47906506-47906528 GGCCAGCCCCGCGGCGGGGAGGG - Intergenic
939275229 2:139990985-139991007 GGCGGACCCCGCCCTGGGAGCGG - Intergenic
947119171 2:226798875-226798897 GCCGCCCCCCGCGCCGGGGAGGG + Exonic
948934054 2:241150719-241150741 GGGGAGCCCCGGCCCGGGGGCGG + Intronic
1169193007 20:3669591-3669613 GGTGAACGCCGCCCAGGGGGTGG + Exonic
1172100875 20:32483515-32483537 GGCCACCCCCGCCCCCGGGCCGG - Intronic
1176310074 21:5144826-5144848 CCCCAACCCCGCCCTGGGGAAGG - Intronic
1176429083 21:6565037-6565059 GCCAGACCCCGCCACGGGGAGGG + Intergenic
1179704573 21:43173353-43173375 GCCAGACCCCGCCACGGGGAGGG + Intergenic
1179846982 21:44117206-44117228 CCCCAACCCCGCCCTGGGGAAGG + Intronic
1180702953 22:17791545-17791567 GTAGAAACCAGCCCCGGGGAGGG - Intronic
1180791827 22:18578736-18578758 GGCCAGCCCAGCCCCTGGGAAGG - Intergenic
1181229909 22:21416573-21416595 GGCCAGCCCAGCCCCTGGGAAGG + Intergenic
1181248740 22:21518293-21518315 GGCCAGCCCAGCCCCTGGGAAGG - Intergenic
1182114757 22:27749802-27749824 GGGCAACCCCACCCCTGGGAGGG - Exonic
1182735392 22:32529336-32529358 GGCCAGCCCCGACCCTGGGAGGG - Intronic
1184070341 22:42143034-42143056 GCCAAACCCCGCCCCAGGCAGGG - Intergenic
1184679424 22:46062088-46062110 GGAGCACCCGGCCCCGGGGCGGG - Intronic
1185044924 22:48523990-48524012 GGCCAGCCCGGCCCCGGGGCAGG - Intronic
954210356 3:49093737-49093759 AGCGCACCCCGCCCTGTGGATGG - Intronic
954367642 3:50154950-50154972 GGCGGGTCCCGCCCCGGGGGTGG + Intergenic
955818690 3:62874426-62874448 GGCGAGCCCGGCCGCTGGGAGGG + Intronic
961037447 3:123652535-123652557 GGGCACCCCCGCCCCGGAGACGG + Intronic
961574299 3:127822527-127822549 GCCGCTCCCCGCCCTGGGGAGGG - Exonic
963028302 3:140941946-140941968 GACGCACAGCGCCCCGGGGACGG - Exonic
972511099 4:39769716-39769738 GGCTAAGCCTGCCCAGGGGAAGG - Intronic
980923895 4:139115317-139115339 GGCGACCCCGGCCCCCGGGCCGG - Intronic
983533416 4:168833065-168833087 GGCCGGCCCCGCCCCGGGGCTGG + Intronic
985472150 5:53203-53225 GGCGTCCCACGCACCGGGGACGG + Intergenic
988481967 5:31638984-31639006 AGCGAGCCCCGCCGCGGGCAAGG - Intergenic
997500682 5:134371323-134371345 GGGGAACCGCGCCCCGCTGAAGG + Exonic
999281965 5:150372077-150372099 GGCGGCCCCAGCCCCTGGGAAGG + Exonic
1002405064 5:179024033-179024055 GGTGAACCCGGCCCCGGAGGGGG + Intronic
1006188799 6:32195507-32195529 GGTGATCCCCGCTCCGGGGACGG + Exonic
1007781433 6:44257074-44257096 GGCGGATCCGCCCCCGGGGAGGG - Intronic
1009624985 6:66127230-66127252 GGCAAACCCCGCCACAGGGAAGG - Intergenic
1013099186 6:106973779-106973801 GGGGAACCTCGCCCCGGGTGCGG - Exonic
1015376092 6:132512671-132512693 GGCGGAGCGCACCCCGGGGAGGG - Intronic
1016657938 6:146543356-146543378 GCCGACCCCGGCCCCGGGGGGGG + Intergenic
1019055766 6:169222247-169222269 GGTGAACTCCACCACGGGGACGG - Exonic
1019286908 7:228247-228269 GGCGACCCCTGCCCTGGGCAGGG + Exonic
1019405623 7:882525-882547 GGCCGACCTTGCCCCGGGGATGG + Intronic
1019405648 7:882599-882621 GGCCGACCTTGCCCCGGGGATGG + Intronic
1019405662 7:882636-882658 GGCCGACCTTGCCCCGGGGATGG + Intronic
1019405676 7:882673-882695 GGCCGACCTTGCCCCGGGGATGG + Intronic
1019478433 7:1255172-1255194 GGCCAGCCCCGCCCCAGGGCAGG - Intergenic
1029435430 7:100561684-100561706 GGAGAACCCCGCAGCGGGGCTGG + Intronic
1029611785 7:101630494-101630516 GGAGAACCCAGCTCTGGGGACGG + Intergenic
1034853968 7:154522966-154522988 GGCGATCCCCGCCCCAGAGGTGG - Intronic
1035553475 8:545985-546007 GGCGACCCCCGATCCCGGGACGG + Intergenic
1044934160 8:97277520-97277542 GGCCAGGCCCGGCCCGGGGAAGG - Exonic
1053381186 9:37650822-37650844 CGCGACCCCCGCCCCGGGGGAGG - Intronic
1054820481 9:69516280-69516302 GGCGACCCCCGGCCGGGGTAGGG + Exonic
1061400981 9:130368275-130368297 GGTCAACCCCTCCCCGGGGAGGG + Intronic
1062102863 9:134737645-134737667 GAGGAATCCCGCCCTGGGGAAGG + Intronic
1062518538 9:136947783-136947805 GGGGAGCCCCGCCCGTGGGATGG - Intronic
1203776653 EBV:77006-77028 GGCCAACCCAGCCCTGGTGAGGG + Intergenic
1195941619 X:110172310-110172332 TGCGACACCTGCCCCGGGGACGG - Intronic
1196379049 X:115069142-115069164 GGCAGACCCTGCCCCTGGGAGGG - Intergenic
1199996823 X:153030968-153030990 GGGGCAGCCTGCCCCGGGGACGG - Intergenic
1200163333 X:154020007-154020029 GGGGCGCCCCGCGCCGGGGAGGG + Intergenic