ID: 1142419886

View in Genome Browser
Species Human (GRCh38)
Location 16:89963684-89963706
Sequence GTGGTCAACCTGCCTGACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142419886_1142419888 -5 Left 1142419886 16:89963684-89963706 CCCTCGTCAGGCAGGTTGACCAC 0: 1
1: 0
2: 1
3: 3
4: 79
Right 1142419888 16:89963702-89963724 ACCACAAAACACAGTTTTCAAGG 0: 1
1: 0
2: 2
3: 34
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142419886 Original CRISPR GTGGTCAACCTGCCTGACGA GGG (reversed) Intronic
901029574 1:6299130-6299152 GAGGGCAACCTGCCTGCCCAAGG - Intronic
904087270 1:27917760-27917782 GTGTACAACCTGCCTGGAGAGGG - Intergenic
905065557 1:35178443-35178465 GTGGTCAGCCTGCCTGACAATGG - Intronic
905345547 1:37308830-37308852 GGGGTCAGCCTGCCTGAGGATGG + Intergenic
906634161 1:47397176-47397198 TTGGTCAACCTACCTGCAGAGGG + Intergenic
919403168 1:197146056-197146078 ATCGTCAACCTTCCTGAGGAGGG + Intronic
1069857582 10:71450132-71450154 GAGGCCAACCAGCCTGACCAGGG - Intronic
1076662373 10:132064364-132064386 GGGGACAACCTTCCTGACGAGGG - Intergenic
1077328191 11:1972633-1972655 GTGGTCAACCTGGGGGACCAGGG + Intronic
1089674775 11:120082335-120082357 GTGGTCCACCTGCCTCACCTTGG + Intergenic
1089674796 11:120082446-120082468 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089674926 11:120083143-120083165 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675056 11:120083840-120083862 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675087 11:120083985-120084007 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675095 11:120084022-120084044 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675124 11:120084170-120084192 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675177 11:120084429-120084451 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675185 11:120084466-120084488 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675193 11:120084503-120084525 GTGGTCCACCTGCCTCACCCCGG + Intergenic
1089675204 11:120084540-120084562 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675231 11:120084651-120084673 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675247 11:120084725-120084747 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675278 11:120084873-120084895 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675286 11:120084910-120084932 GTGGTCCACCTGCCTCACCCCGG + Intergenic
1089675296 11:120084947-120084969 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675323 11:120085058-120085080 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675331 11:120085095-120085117 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675347 11:120085169-120085191 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675378 11:120085317-120085339 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675386 11:120085354-120085376 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675401 11:120085428-120085450 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675434 11:120085576-120085598 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675442 11:120085613-120085635 GTGGTCCACCTGCCTCACCTTGG + Intergenic
1089675450 11:120085650-120085672 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675458 11:120085687-120085709 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1089675467 11:120085724-120085746 GTGGTCCACCTGCCTCACCTCGG + Intergenic
1202811170 11_KI270721v1_random:27813-27835 GTGGTCAACCTGGGGGACCAGGG + Intergenic
1091407875 12:220424-220446 CTGGTCCACATGCCTGATGATGG + Intergenic
1092684216 12:11023528-11023550 GTAGTCACCCTGCCTGAGGTGGG - Intronic
1094207873 12:27859730-27859752 GTGCTCACCCTGCCTGCCCAAGG - Intergenic
1096851272 12:54439289-54439311 GTGGACACCCTGCCTGCCAATGG - Intergenic
1097469912 12:59976623-59976645 GTGTTCAACCTACCTCACCATGG + Intergenic
1101221996 12:102651185-102651207 GTCTTCAACCTGACTGACGTTGG - Intergenic
1111110609 13:83704030-83704052 TTGATCAACCTTCCTGATGAGGG + Intergenic
1111532471 13:89556855-89556877 GTGCTGAGCCTGCCTGATGAAGG - Intergenic
1114656074 14:24316366-24316388 GTGGTGAACCTGGCTGAGGCGGG + Exonic
1117286854 14:54294087-54294109 ATGGTCTGCCTGCCTGAGGATGG + Intergenic
1121925930 14:97927250-97927272 GTGTTCATCCTGCTTGACAAAGG + Intronic
1122778052 14:104131513-104131535 GAGGTCAACCTGGCTGACTTAGG + Intergenic
1129080381 15:73034050-73034072 GTGGTGAACCTGCCTGCACAGGG + Intergenic
1132657406 16:1046996-1047018 GTGGTCTGCCTGCCTGAGGGTGG + Intergenic
1142419886 16:89963684-89963706 GTGGTCAACCTGCCTGACGAGGG - Intronic
1145904878 17:28510820-28510842 GTGGTCAATCTGCCTAAAGTGGG + Intronic
1146061359 17:29609095-29609117 GTGGTCAATCTCCATGACCACGG - Exonic
1152245444 17:79182743-79182765 GTGGGCCACCCGCCTGGCGAGGG - Intronic
1152794079 17:82298407-82298429 CTGGGCAACCTTCCTGAGGACGG + Intergenic
1167827126 19:51983938-51983960 GTGGTCCACCTGCCTGAAGGGGG - Intronic
935951457 2:108333247-108333269 GTGCTCAACTTGCCTGATGCAGG - Intergenic
936280701 2:111137271-111137293 GTGGTCATCCTGCCTGTCACAGG + Intronic
942145608 2:173023554-173023576 GGGGTCAACCTGCCCTACGCCGG + Intronic
1169939357 20:10920082-10920104 TTTGTAAACCTGCCTGATGATGG - Intergenic
1172217820 20:33248849-33248871 GTGGTCAATCTGCCACACCAGGG + Intergenic
1180023647 21:45145934-45145956 GTGGTCAACATGACTGGCAAAGG - Intronic
1183094408 22:35543489-35543511 GAGGTCAGCCTGGCTGAGGATGG + Intronic
1184516687 22:44966535-44966557 GTGGTCTCCCTGCCTGCCCAGGG - Intronic
949657883 3:6242304-6242326 CTGGTCATCCTCCCTGAAGAAGG + Intergenic
960527012 3:118721414-118721436 GTGGACTGCCTTCCTGACGAGGG + Intergenic
975768555 4:77695995-77696017 GTGGTAAATCTGCCTGAGGTGGG + Intergenic
979057734 4:116016802-116016824 CTGGTCAACCTCCCAGAGGAGGG - Intergenic
984989696 4:185368301-185368323 GGAGTCACCCTGCCTGACGGTGG + Intronic
985956300 5:3268573-3268595 GTGGCCACCCTGCCTGTCGTGGG + Intergenic
989178156 5:38550074-38550096 GCGGTGAACATGCCTGACTAAGG + Intronic
990611010 5:57456922-57456944 GTGGTCAGCCTCCCTGCGGAAGG + Intergenic
993416311 5:87637412-87637434 GTGGTCCATCTGCCTGAACAGGG - Intergenic
997668088 5:135648328-135648350 GCAGCCAGCCTGCCTGACGATGG + Intergenic
1004179068 6:13365292-13365314 GTGGTCAGTCTGCTTCACGAAGG + Exonic
1022641581 7:32190383-32190405 TTGGTCTACCTGCCTGTCCAGGG + Intronic
1031644151 7:124202775-124202797 GTGGGCAGCCTGCCTGACCTTGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1042345449 8:67722220-67722242 GAAGTCAAGCTGCCTGCCGAAGG - Intronic
1060224396 9:121782491-121782513 ATTGTTAACCTGCCTGAGGAGGG + Intronic
1060299385 9:122366024-122366046 GTGTTCCACATGCCAGACGAGGG + Intergenic
1062285420 9:135770574-135770596 CAGGTCATCCTGCCTGGCGAGGG + Intronic
1195573598 X:106424371-106424393 GTAGTCCACCTGACAGACGATGG - Intergenic