ID: 1142421218

View in Genome Browser
Species Human (GRCh38)
Location 16:89971833-89971855
Sequence CACTTCCAATTTGAGGTCAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142421214_1142421218 -3 Left 1142421214 16:89971813-89971835 CCCGCTTCAAATCGTCGTAACAC 0: 1
1: 0
2: 0
3: 1
4: 18
Right 1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1142421213_1142421218 23 Left 1142421213 16:89971787-89971809 CCTTTGCGATCTGACTGAGCTTC 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 138
1142421215_1142421218 -4 Left 1142421215 16:89971814-89971836 CCGCTTCAAATCGTCGTAACACT 0: 1
1: 0
2: 0
3: 1
4: 35
Right 1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142421218 Original CRISPR CACTTCCAATTTGAGGTCAA GGG Exonic
902840234 1:19069745-19069767 CACTTCCCATCAGAGGGCAAGGG - Intergenic
905102827 1:35540489-35540511 CACTTCCAACTTGGGGGCAAAGG + Intronic
905650419 1:39652806-39652828 TACTTCCCAATTAAGGTCAATGG + Intergenic
907545482 1:55256227-55256249 ACCTTCCAATTTGAGGTCATAGG - Intergenic
909515455 1:76502172-76502194 CTCTACCTATTTGAGATCAAGGG + Intronic
910052063 1:82986548-82986570 CCCTGCCAATTTGAGGGCATAGG - Intergenic
913814210 1:122943827-122943849 TTCATCCGATTTGAGGTCAATGG + Intergenic
913851617 1:123613696-123613718 TTCAGCCAATTTGAGGTCAATGG + Intergenic
913863158 1:123820694-123820716 TTCATCCGATTTGAGGTCAATGG + Intergenic
915670326 1:157483470-157483492 CCCATCCAATTAGAGGGCAAAGG + Intergenic
918637574 1:186796748-186796770 AACTCCCAGTCTGAGGTCAAAGG + Intergenic
921165239 1:212502280-212502302 CACTTCCCAGAGGAGGTCAAGGG - Intergenic
924251950 1:242141697-242141719 CACTTCCAGAATGAGGTCAGAGG - Intronic
1066229484 10:33418490-33418512 CACTTCCCATTTCATGTCCAAGG + Intergenic
1068865731 10:61894205-61894227 TACTTCCAATCTGAGTCCAAAGG + Intergenic
1070690679 10:78522652-78522674 CATGTCCAATATTAGGTCAAAGG + Intergenic
1076115276 10:127891279-127891301 GATTTCCAATTTGAGATAAATGG - Intronic
1077379039 11:2219644-2219666 CACTTCCATTTAGATTTCAAAGG - Intergenic
1078653330 11:13215984-13216006 AAATTCCTATCTGAGGTCAATGG + Intergenic
1078743159 11:14087713-14087735 CACTGTCAATTTTAGATCAATGG - Intronic
1079292023 11:19196865-19196887 CTCTTCCAAGTTGATGTCACAGG - Intronic
1081142070 11:39513809-39513831 CACTGCCAATTTGAACTGAAAGG + Intergenic
1081415348 11:42808303-42808325 CACATCCAACTTGCTGTCAATGG + Intergenic
1081739532 11:45428589-45428611 CACTACCAATTAGAGCTAAATGG - Intergenic
1086051826 11:82601269-82601291 CCCTTCCCATGTGAGGTCACAGG - Intergenic
1086199865 11:84189084-84189106 CAGTTCTAATTTTAGGACAATGG + Intronic
1089657866 11:119964779-119964801 CACTTCTAATTTGAGGCAACAGG + Intergenic
1091112232 11:132980441-132980463 CACTTCCTATTTTAGTTCTAGGG - Intronic
1094317230 12:29148229-29148251 CACTTCCTGGTTGAGGCCAAGGG + Intergenic
1097080060 12:56423346-56423368 GGCTTCCATTTTGAGGTCATGGG + Exonic
1098089375 12:66884933-66884955 CAGTTCTAATTTGAAGTCCAAGG - Intergenic
1098194565 12:67986051-67986073 AAGTTCCAATTTGAGTTCGAAGG - Intergenic
1099057679 12:77865966-77865988 AACTTATAATGTGAGGTCAATGG - Intronic
1101701386 12:107177631-107177653 CAGTTCCAGTCTGAGCTCAAAGG + Intergenic
1101791834 12:107934711-107934733 CACTTCCTAAGTGAGGTCAGGGG + Intergenic
1104744961 12:131204739-131204761 CACTGCCAAAATCAGGTCAAAGG + Intergenic
1104789444 12:131472661-131472683 CACTGCCAAAATCAGGTCAAAGG - Intergenic
1106315541 13:28590188-28590210 CACTTACACTCTTAGGTCAATGG + Intergenic
1109599900 13:64611804-64611826 CATCTCCAATTTTAAGTCAAGGG - Intergenic
1112914677 13:104533468-104533490 CAGTTTCAATTTGAGGGAAAGGG + Intergenic
1115923968 14:38410405-38410427 CACATCCATGTTGTGGTCAATGG + Intergenic
1117178095 14:53165654-53165676 CACTTGAAATTTCAGGTGAAAGG - Intergenic
1117514920 14:56491496-56491518 CACTGCCATCTTGAGGTCACTGG - Intronic
1117571480 14:57053257-57053279 AAATTCCAATTTCAGATCAATGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118678173 14:68211263-68211285 TACTTCCACTTTTAGTTCAAGGG + Intronic
1119592198 14:75900267-75900289 CACTTTCATTTTGAGGACAAGGG - Intronic
1120509482 14:85396282-85396304 CTCCTCCAATTTTAAGTCAAAGG - Intergenic
1121566682 14:94915163-94915185 CATTACCAATTTAAGGTCAGTGG - Intergenic
1122383159 14:101324595-101324617 ATCTTCCAATTTGACCTCAAAGG - Intergenic
1122453140 14:101827892-101827914 CACTTCCAATATGAGGTTATAGG - Intronic
1123971745 15:25514233-25514255 CACTCTCATCTTGAGGTCAATGG - Intergenic
1125540370 15:40466514-40466536 CACTCCCCCTTTGAGGGCAAGGG - Exonic
1126994019 15:54418864-54418886 TGCTTCCAAGTTTAGGTCAATGG - Intronic
1130679788 15:85986384-85986406 CTCTTCCAAGTTGTGGCCAAAGG + Intergenic
1130973265 15:88752320-88752342 CACTTCTAATATGAGGTTACAGG + Intergenic
1131572986 15:93558069-93558091 AATTTCCTGTTTGAGGTCAATGG - Intergenic
1132349203 15:101128068-101128090 CAATTCCAATTCCAGGTCCAGGG + Intergenic
1132384459 15:101390280-101390302 CACTTCCCGTTTGAGTCCAACGG - Intronic
1133783291 16:8955793-8955815 TGCTTGCAACTTGAGGTCAATGG + Intronic
1136008445 16:27346998-27347020 CAGTTCCCTTTTGAGGCCAACGG + Intronic
1136580149 16:31146682-31146704 CACTCAGAATCTGAGGTCAAAGG + Intronic
1140834227 16:78778682-78778704 CACCTCCTGTTTGAGTTCAAGGG + Intronic
1142421218 16:89971833-89971855 CACTTCCAATTTGAGGTCAAGGG + Exonic
1144497101 17:15754917-15754939 TACCTCCAATTTGTGGGCAAAGG - Intergenic
1144606665 17:16672161-16672183 TACTTCCAATTTGTGAGCAAAGG - Intergenic
1144904530 17:18629997-18630019 TACCTCCAATTTGTGGGCAAAGG + Intergenic
1146362453 17:32188349-32188371 CAATTCCAATTGAAGGTTAATGG - Intronic
1148878518 17:50707524-50707546 AACTCCCAAAATGAGGTCAACGG - Exonic
1151653878 17:75486417-75486439 CAAATCCAAGGTGAGGTCAAGGG + Exonic
1152371097 17:79889081-79889103 CACTCTCAGTTTGAGGCCAAAGG - Intergenic
1153376881 18:4390889-4390911 CACTTCCAGTTACAGGTCAGAGG - Intronic
1160260050 18:77284668-77284690 CACATCCAATTTGATTTCAAAGG + Intergenic
1161492628 19:4570592-4570614 GACTTCCAATTTGGGGTACAGGG - Intergenic
1162152979 19:8658502-8658524 CACTTCCAACTTTAGGACAATGG - Intergenic
926565604 2:14468145-14468167 CACTTTCAACTTGATGTCTAGGG + Intergenic
927973769 2:27322619-27322641 CACTTCCAATGTGACTTAAAGGG + Intronic
941159697 2:162022423-162022445 AACTTCAAATGTGAGGTCACTGG + Intronic
941703740 2:168635174-168635196 CACTGCCACTGTGAGGACAAGGG + Intronic
945839513 2:214870577-214870599 CACTACCAATTGGATGTAAAAGG + Intergenic
948793184 2:240389517-240389539 CTCTTCCAGCTTGAGGTCACAGG - Intergenic
1169550914 20:6700372-6700394 CACTTAATAATTGAGGTCAATGG + Intergenic
1172648162 20:36484402-36484424 CACTCCCCAGTTGGGGTCAAGGG - Intronic
1174774909 20:53334559-53334581 CACTTCCAGTGTGCGGCCAAGGG + Intronic
1175154743 20:56962884-56962906 CACTTCCAAGGTGATGTCCAAGG - Intergenic
1175420914 20:58832936-58832958 CACTCACAATTAGAGGACAACGG - Intergenic
1177798764 21:25806849-25806871 TACTCTCAATCTGAGGTCAAAGG - Intergenic
1179176486 21:39011567-39011589 CAGTTCCCATCTGAGTTCAAAGG + Intergenic
1181990375 22:26832468-26832490 CACTCTCAAGTTAAGGTCAATGG - Intergenic
951831911 3:26939676-26939698 CACTTCCAATTTTAAATTAATGG - Intergenic
953735698 3:45492302-45492324 CACTTCCAAAATGAGGAGAAAGG - Intronic
960206219 3:114902999-114903021 TTATTCCAATGTGAGGTCAATGG + Intronic
961703117 3:128762494-128762516 CACTTCCATTTTGAGGGTCACGG - Intronic
962448886 3:135494787-135494809 CTCTTCCAAATTGAGGCAAAGGG + Intergenic
964297977 3:155254626-155254648 AACTCCCAGTCTGAGGTCAAAGG - Intergenic
969906725 4:10404041-10404063 CACTTGGAAAGTGAGGTCAAAGG - Intergenic
973046976 4:45546151-45546173 AACTTTCATTTTGAGGTCGAGGG - Intergenic
973174162 4:47183786-47183808 CTATTCCACTTTGAGGTCAGTGG + Intronic
975009336 4:69329553-69329575 CTCTTACCATTTGAGGACAAAGG + Intronic
975910472 4:79260244-79260266 CACTTTTATTTTGAGGTTAATGG + Intronic
976822269 4:89219884-89219906 CACCTCCTGTTTCAGGTCAACGG + Intergenic
977781146 4:100982284-100982306 TACTTCCAATTACAGGTCACAGG - Intergenic
981306119 4:143248543-143248565 CACTTCCTATTGGGGGTGAATGG - Intergenic
981341363 4:143625568-143625590 CACTTCCAACATGTGGCCAAAGG - Intronic
983513501 4:168633132-168633154 CACTTCCAAGTGGAGCTCAATGG + Intronic
983768221 4:171514498-171514520 CTCTTAGAATTTGAGGGCAAGGG - Intergenic
984202055 4:176735731-176735753 CCCTTACATTTTCAGGTCAATGG - Intronic
984958884 4:185074784-185074806 CACTGCTAATTGGAGGACAATGG + Intergenic
989910843 5:49648649-49648671 TTCTGCCACTTTGAGGTCAATGG + Intergenic
991176480 5:63693772-63693794 GCCTTCAAATTTGATGTCAAAGG + Intergenic
991281358 5:64917819-64917841 TAGTTCCAGTTTGAGTTCAAAGG - Intronic
991717195 5:69462031-69462053 CACTTCCAATTTGGAATCAGTGG + Intergenic
992108240 5:73468352-73468374 AAATTCCAATTTGAGTGCAAAGG + Intergenic
993013957 5:82514510-82514532 CAGTTGCAATTTGAGTCCAAAGG - Intergenic
996730918 5:126716737-126716759 CACTTCTAATATGAGGTTATAGG + Intergenic
1002441795 5:179268150-179268172 TTCTACCAAATTGAGGTCAAGGG + Intronic
1003595659 6:7471987-7472009 CCCTGCCACTTGGAGGTCAAGGG - Intergenic
1003739778 6:8923236-8923258 CACTTAAAACTTAAGGTCAAAGG - Intergenic
1006530065 6:34644507-34644529 AACTTCCAATCCCAGGTCAAGGG + Intronic
1007853325 6:44827020-44827042 TACTTCCAAATTTAGGTGAAGGG + Intronic
1012063698 6:94519088-94519110 CACTTTCAATTTGTGGACATGGG + Intergenic
1012364582 6:98423174-98423196 CACTTACAATTTGAGGCTATTGG + Intergenic
1016795344 6:148111280-148111302 CAGTTCCAGTCTGAGTTCAAAGG - Intergenic
1017586549 6:155932168-155932190 CAGTTGCAGTTTGAGTTCAAAGG - Intergenic
1018379974 6:163249875-163249897 CACTTCCCTTTTGAGAACAAAGG - Intronic
1021051227 7:15987788-15987810 CAATTCTAATTTGAGTTCAAAGG - Intergenic
1022349508 7:29554414-29554436 CACTTCTAATTCCATGTCAATGG - Intergenic
1022998857 7:35786840-35786862 CAGTTCCATTTTGAGGACTAGGG - Intergenic
1026059392 7:67012630-67012652 CATTTCCAATTTGCGGTTCAGGG - Intronic
1026718698 7:72812392-72812414 CATTTCCAATTTGCGGTTCAGGG + Intronic
1027429938 7:78101223-78101245 CTTTGGCAATTTGAGGTCAAAGG - Intronic
1031762461 7:125731033-125731055 TACTACCAATTTGTAGTCAAAGG + Intergenic
1032571099 7:132998414-132998436 CAGTTCCAAGTTTAGGTTAAAGG - Intronic
1033769571 7:144534436-144534458 AACTTCCAAGTAGAGGTCAGGGG - Intronic
1034384452 7:150727611-150727633 CTCTCCCAGTTTGAGGCCAAAGG - Intronic
1036199309 8:6754029-6754051 CATTTTCAATTTGAGGCCAAAGG + Intronic
1040592024 8:48802288-48802310 CACTTCCAAATGGAGGTAATTGG - Intergenic
1043273831 8:78368332-78368354 CACTTCTGAGTTGAGGTCAATGG - Intergenic
1046010370 8:108539178-108539200 CTTTTCCAAGCTGAGGTCAATGG + Intergenic
1046969102 8:120201392-120201414 AACTACCAATATGAGGTCACAGG - Intronic
1049778322 8:144416332-144416354 CACTGCCAATTTGATGGCAGAGG + Intronic
1051161956 9:14218721-14218743 CACTTCCAATTTCAGCTCCTGGG - Intronic
1059360148 9:113735911-113735933 GACTTCCTATTTGTGGTCAAAGG + Intergenic
1186972346 X:14861182-14861204 CATTTCAAAATTGAGGTCATTGG - Intronic
1187896536 X:23986248-23986270 CACTTCCATTTTATGTTCAATGG + Exonic
1188090168 X:25954035-25954057 AAATTCCAGTTTGAGTTCAAAGG + Intergenic
1189217931 X:39343323-39343345 CTCTTCCAATCTGACCTCAAAGG - Intergenic
1191586099 X:62828265-62828287 CACATTCAATTTGAGGGAAAAGG - Intergenic
1196404645 X:115348457-115348479 CAGCTCCAAGTTGAGATCAATGG - Intergenic
1201490098 Y:14530920-14530942 CACATTAAATTTGAGTTCAAAGG - Intronic