ID: 1142421369

View in Genome Browser
Species Human (GRCh38)
Location 16:89972552-89972574
Sequence CCCTGCGCTCGCGGGGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 225}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142421363_1142421369 -9 Left 1142421363 16:89972538-89972560 CCTGCGCGAGTCCTCCCTGCGCT 0: 1
1: 0
2: 0
3: 13
4: 109
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421356_1142421369 17 Left 1142421356 16:89972512-89972534 CCAGCCGGCGCCGCGCCCCTGCC 0: 1
1: 0
2: 13
3: 100
4: 730
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421362_1142421369 -4 Left 1142421362 16:89972533-89972555 CCGCGCCTGCGCGAGTCCTCCCT 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421357_1142421369 13 Left 1142421357 16:89972516-89972538 CCGGCGCCGCGCCCCTGCCGCGC 0: 1
1: 0
2: 16
3: 101
4: 658
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421355_1142421369 18 Left 1142421355 16:89972511-89972533 CCCAGCCGGCGCCGCGCCCCTGC 0: 1
1: 0
2: 3
3: 38
4: 321
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421358_1142421369 7 Left 1142421358 16:89972522-89972544 CCGCGCCCCTGCCGCGCCTGCGC 0: 1
1: 0
2: 8
3: 71
4: 681
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421353_1142421369 30 Left 1142421353 16:89972499-89972521 CCAAGACGGGGCCCCAGCCGGCG 0: 1
1: 0
2: 1
3: 7
4: 221
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421360_1142421369 1 Left 1142421360 16:89972528-89972550 CCCTGCCGCGCCTGCGCGAGTCC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421361_1142421369 0 Left 1142421361 16:89972529-89972551 CCTGCCGCGCCTGCGCGAGTCCT 0: 1
1: 0
2: 0
3: 7
4: 79
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421354_1142421369 19 Left 1142421354 16:89972510-89972532 CCCCAGCCGGCGCCGCGCCCCTG 0: 1
1: 0
2: 3
3: 49
4: 453
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225
1142421359_1142421369 2 Left 1142421359 16:89972527-89972549 CCCCTGCCGCGCCTGCGCGAGTC 0: 1
1: 0
2: 0
3: 5
4: 52
Right 1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG 0: 1
1: 0
2: 0
3: 25
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142421369 Original CRISPR CCCTGCGCTCGCGGGGCCCT AGG Intergenic
900145799 1:1158203-1158225 CCCGGCGCAGGCGGGACCCTCGG + Intergenic
900201224 1:1407544-1407566 CGCTGCCCTCACGGTGCCCTCGG - Intergenic
900290616 1:1922107-1922129 CCCTGGGCTTGCGGGGTCCAGGG + Exonic
901018761 1:6245623-6245645 CCCTGCGCTTGCGGGGTGCGCGG - Intergenic
901319261 1:8329837-8329859 CCCTGAGCTGGAGGGGCCCTCGG + Intronic
901520228 1:9778039-9778061 CCCTGAGGTCGCGGGCCCTTTGG - Intronic
902787166 1:18740185-18740207 CCCTGCCCTCGCCGGCCCCTCGG + Intronic
903221126 1:21870236-21870258 CCCTGCCCTCTGGGGGCTCTGGG + Intronic
903772520 1:25772820-25772842 CTCTGTGCTCTCTGGGCCCTGGG + Intronic
904599229 1:31664685-31664707 CCCTGCCCTCTCTGGGCCCTTGG + Intronic
906543284 1:46604337-46604359 CCCTGCCCTCAGGCGGCCCTGGG - Intronic
915797478 1:158752226-158752248 CTCTGCGCTCCTGGGGTCCTGGG - Intergenic
916648818 1:166816499-166816521 CCCTGCTCTGGCTGAGCCCTGGG + Intergenic
916966234 1:169945320-169945342 CCCTGTGCTCTTGGGGGCCTGGG - Intronic
924415345 1:243850864-243850886 CCCCTCGCCCGCGTGGCCCTTGG + Intronic
1063859766 10:10294919-10294941 CCCTGCACTCTCGGAGCCCAGGG - Intergenic
1065201555 10:23317351-23317373 CCCTGTGCTCTTGGGGGCCTAGG - Exonic
1066023082 10:31320830-31320852 CCCTGCGCTCCCGCCGCCCCCGG - Intronic
1066188807 10:33036901-33036923 CCCTGCACTCTCGGGGGCCCAGG + Intergenic
1067058863 10:43067601-43067623 CCCTGCACTCATGGGGACCTAGG - Intergenic
1067725778 10:48769714-48769736 CCCAGCGCTCGCTGGGCTTTGGG + Intronic
1068955353 10:62815605-62815627 CCCTGCGCTCGCCCGGGGCTGGG + Intronic
1070428687 10:76315374-76315396 CCCTGTGCTCTCAGGGGCCTGGG + Intronic
1072753219 10:97999270-97999292 CCCTGCACTCTTGGGGGCCTGGG + Intronic
1073043228 10:100621468-100621490 CCCTGCGCTGGGGGCGCCCTCGG + Intergenic
1073051007 10:100667504-100667526 CCCTGCCCTTGCGGAGCCTTCGG + Intergenic
1075393785 10:122112835-122112857 CTCTGCGGCCGCGGGCCCCTCGG + Intronic
1075520831 10:123142722-123142744 CCTTGCGCCCGCGGGGCACCTGG + Intergenic
1076816134 10:132915532-132915554 CCCCGCCCTCGCCGGTCCCTTGG - Intronic
1076816164 10:132915618-132915640 CCCCGCCCTCGCCGGTCCCTCGG - Intronic
1077254095 11:1572816-1572838 CCCTGCACTCGGGCGGACCTGGG + Intergenic
1077378465 11:2216404-2216426 CCCTGCTCTCCCAGGGGCCTGGG - Intergenic
1077602028 11:3580881-3580903 CCCTGCGCCCCCGGGACCCCCGG + Intergenic
1078565419 11:12410192-12410214 CCCTGCAGTCCCGGGGGCCTGGG - Intronic
1084178615 11:67435844-67435866 CCCTGCGCTCGCTGGTCCTGGGG + Exonic
1084180499 11:67443403-67443425 CCCTGCGCCCCCGGTGCCCCCGG - Exonic
1084361373 11:68670352-68670374 ACCAGCTCTCGAGGGGCCCTGGG + Intergenic
1084491990 11:69483949-69483971 GCCTGCCCCTGCGGGGCCCTTGG - Intergenic
1084730782 11:71072182-71072204 CCCTGGGCTCACGGGGGCATAGG - Intronic
1088288088 11:108207728-108207750 CCCTGCACTCTCGGGGGCCAGGG - Intronic
1089822518 11:121241378-121241400 CCCTGCTCTGGCAGGGCCCAGGG + Intergenic
1090041826 11:123298771-123298793 CGCTGCGCTCTCAGGGACCTGGG + Intergenic
1090803476 11:130188735-130188757 GCCTGTGCTCCCAGGGCCCTGGG + Intronic
1094813986 12:34166346-34166368 CTCTGTGCGCTCGGGGCCCTTGG - Intergenic
1095102930 12:38202171-38202193 CTCTGTGCGCTCGGGGCCCTTGG + Intergenic
1096232567 12:49904410-49904432 CCCTGCGCTCCTGTGGGCCTGGG + Intergenic
1096345523 12:50842898-50842920 CCCTGGGCACGCGGGGCGCACGG - Intronic
1096602167 12:52737070-52737092 CCCTGCTCTGGCTGTGCCCTGGG + Intergenic
1103309033 12:119989725-119989747 CCCAGGGCTCGCGGGGACCCGGG + Intergenic
1103363783 12:120368677-120368699 CCCTGCGCTCTCGGGGTCTCCGG + Intronic
1103764430 12:123271001-123271023 CCCTGAGGTCGCGGGGCCGCCGG - Intronic
1105954617 13:25268860-25268882 CCCTGTGCTCTTGGGGGCCTAGG + Intronic
1107841037 13:44458624-44458646 CCCTGTGCTCTCGGGGACCCAGG + Intronic
1108088296 13:46818514-46818536 CCCTGCTCTGGCTGGGCCCAGGG - Intergenic
1108854509 13:54775886-54775908 CCCTGTGCTCTTGGGGGCCTGGG - Intergenic
1110630109 13:77697883-77697905 CCCGGCGGCCGCGGCGCCCTCGG + Intronic
1111091396 13:83452467-83452489 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
1111141744 13:84127779-84127801 CCCTGCGCTCTTGGGGGCCCAGG - Intergenic
1111253673 13:85639103-85639125 CTCTGCACTCTCGGGGGCCTGGG - Intergenic
1111474253 13:88725144-88725166 CTCTGTGCTCTCGGGGGCCTGGG + Intergenic
1113841501 13:113364019-113364041 CCGAGCGCTCGCGGGTCCCCAGG - Exonic
1116790072 14:49330332-49330354 CCCTGTGCTCTTGGGGGCCTAGG - Intergenic
1116961553 14:50973059-50973081 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
1117392058 14:55271633-55271655 GCCTGCGCTCCCGGGGCGCGGGG + Intronic
1117930784 14:60838744-60838766 CCCTGCACTCTCGGGGGTCTGGG + Intronic
1118218558 14:63832922-63832944 CCCAGCTCTCGGGAGGCCCTGGG + Intergenic
1118316864 14:64730974-64730996 CCCTGCCCTCCCCAGGCCCTAGG - Intronic
1121439338 14:93939039-93939061 CCATGCGCGCGCGCGTCCCTGGG + Intronic
1121695400 14:95908266-95908288 CCCTGCACTCTTGGGGACCTGGG - Intergenic
1122108728 14:99480687-99480709 CTCTGCGCCCGCGCGGCCCGCGG - Intronic
1122293655 14:100693120-100693142 CCTTGCGCTCGCTGGCGCCTGGG + Intergenic
1123061788 14:105597822-105597844 CCCTGCCCTGGCCGGGCCCCTGG + Intergenic
1123086526 14:105719553-105719575 CCCTGCCCTGGCCGGGCCCCTGG + Intergenic
1124244199 15:28056052-28056074 CCCTGCACTCCAGGGGCCCCTGG + Intronic
1125464190 15:39934375-39934397 CCCTGGCCTCCCCGGGCCCTGGG + Intronic
1126682257 15:51213828-51213850 CCCTGCACTCACGGGGCTCATGG - Intronic
1129710975 15:77820059-77820081 CCCGCCGCTCGCGGGGCCCAGGG + Intronic
1129862395 15:78872789-78872811 CCCTGCGCCCGCGCCGCCCCAGG - Intronic
1130353083 15:83108059-83108081 CCCTGCCCTGGAGGGGCCCAGGG + Intronic
1130907269 15:88249527-88249549 CCCTGCCCACTCTGGGCCCTTGG + Intronic
1131828763 15:96341261-96341283 CCCGGCGCTCGCGGTGCAGTGGG - Intergenic
1132406409 15:101544038-101544060 CCCTGCGCGCGCGGGGCAGGGGG - Intergenic
1133055550 16:3143941-3143963 CCCTGGGCTCTCAGTGCCCTGGG - Intergenic
1139678070 16:68539202-68539224 GCCTGCGCGCGCGGGCCTCTGGG + Exonic
1141973339 16:87496991-87497013 CCCTCCTCTCGTGGGGTCCTAGG - Intergenic
1142130004 16:88428091-88428113 CCCTGCTCTGGGGGGGCCCCGGG - Exonic
1142421369 16:89972552-89972574 CCCTGCGCTCGCGGGGCCCTAGG + Intergenic
1142763749 17:2055150-2055172 CCCTCCGCCCGCCGGGCCCCCGG - Intronic
1144665087 17:17096931-17096953 CCCTGCGATGGCTGGCCCCTTGG - Intronic
1144742569 17:17592087-17592109 CCCTGGGCGTGTGGGGCCCTGGG - Intergenic
1146547068 17:33748976-33748998 CCCTGGGCTCAGGGGGCCCTCGG + Intronic
1149657370 17:58317394-58317416 CCCTGAGGTTGCGGTGCCCTGGG - Intronic
1151429279 17:74051596-74051618 CTTTGCTCTCGCGGGGCCCTAGG - Intergenic
1151705249 17:75763946-75763968 CCCAGCGCTCGCTGGAGCCTGGG - Exonic
1151802141 17:76384853-76384875 GCCCGCCCTCGCGGGGCCCCGGG + Exonic
1152226605 17:79095657-79095679 CCCTGTGCGGGTGGGGCCCTGGG + Intronic
1152352061 17:79789771-79789793 CCCATCGCTCCCGGTGCCCTCGG - Intergenic
1152433244 17:80260841-80260863 CCCTCGGGTCACGGGGCCCTGGG - Intergenic
1152468098 17:80476837-80476859 CCCTGAGCTCTCGGAGCCTTCGG - Intronic
1152628500 17:81399324-81399346 GCGTGCGCGCGCGGGGCCCCGGG + Intronic
1152636817 17:81433585-81433607 CCCTGAGCACACGGGGACCTCGG - Intronic
1152636863 17:81433747-81433769 CCCTGAGCACACGGGGACCTCGG - Intronic
1152738506 17:82008898-82008920 CCCTGCGCTGGCCGGGGCCAGGG + Intronic
1156651931 18:39235428-39235450 CCCTGCACTCGGAGCGCCCTGGG + Intergenic
1157610285 18:48951437-48951459 CCCTGCGCTCCTGGGGGCCCAGG + Intergenic
1158198177 18:54910929-54910951 CCCTGCACTCCTGGGGGCCTTGG - Intronic
1159766998 18:72502902-72502924 CCCTGCACTCTTGGGGTCCTGGG - Intergenic
1160053232 18:75455888-75455910 CCCCGCGCTCGCGGGTTCCCGGG - Intergenic
1160381288 18:78458155-78458177 CACTGAGCTCTCAGGGCCCTCGG - Intergenic
1160392183 18:78542388-78542410 CCCTGCCCTCCCGCGGCTCTTGG - Intergenic
1160514906 18:79472810-79472832 CCCTGGCCTCGCGGCGCTCTGGG + Intronic
1160837621 19:1132138-1132160 CCCGGCGCTCGGGGGGCCAGGGG + Intronic
1160930092 19:1566450-1566472 CCCTGCCTCCCCGGGGCCCTCGG - Intronic
1161086964 19:2339790-2339812 CCATGGGGTCGTGGGGCCCTGGG - Intronic
1161340772 19:3740770-3740792 CCCGGAGCTGGAGGGGCCCTGGG + Intronic
1161443308 19:4304695-4304717 CCCAGCGTGCGCGGGGCCCGCGG + Exonic
1163034454 19:14563025-14563047 CACTGCACTGGCAGGGCCCTCGG + Intronic
1163723687 19:18910617-18910639 CCCTGCCCCCGCTGCGCCCTGGG + Intronic
1167495838 19:49818355-49818377 CCCGGCGCGGGCCGGGCCCTCGG - Exonic
1168267726 19:55231560-55231582 CCCTGCCCACCCGCGGCCCTGGG - Intronic
1168630312 19:57950882-57950904 CCCTGCACTCTTGGGGACCTGGG - Intergenic
926547106 2:14255514-14255536 CCCTGTGCTCTCGGGGACCCAGG - Intergenic
927151657 2:20199737-20199759 CCCTGCCCTGGGGGTGCCCTGGG + Intergenic
928470366 2:31569017-31569039 CCCTGTGCTCTCAGGGGCCTGGG - Intronic
929647049 2:43637745-43637767 CCCTGACCGCGCGGGTCCCTCGG - Intronic
929983138 2:46699310-46699332 CGCTGCGCTCGCTGGGCAGTCGG + Intronic
933759638 2:85664826-85664848 CCCTGGGCTGGCGGGGCCATTGG + Intronic
934079008 2:88452154-88452176 CGCCGCGCCCGCGGGGCCCGGGG - Exonic
937905253 2:127049923-127049945 CCCTGTGCACGCAGGGCCATGGG - Intronic
938381176 2:130837303-130837325 TCCTGGGCGCGCGGGGCACTCGG + Intronic
939085052 2:137708515-137708537 CCCTGTACTCTCGGGGGCCTAGG - Intergenic
939801778 2:146720294-146720316 CCCTGTGCTCTCAGGGACCTGGG + Intergenic
939837588 2:147149989-147150011 CCCTGCGCTCTTGGGGGCCCAGG + Intergenic
943191763 2:184686160-184686182 CCCTGCACTCTTGGGGGCCTGGG - Intronic
943950575 2:194129127-194129149 CCCTGTGCTCTCGGGAACCTGGG - Intergenic
943960139 2:194254033-194254055 CCCTGCGCTCTTGGGGGCCTGGG + Intergenic
944675996 2:202034428-202034450 CCCTGCACTCGCAGGGCCGCCGG - Intergenic
945395224 2:209307786-209307808 CCCTGTGCTCTCAGGGGCCTGGG - Intergenic
948529646 2:238596151-238596173 CCCTGCTCTCGTGGAGGCCTGGG + Intergenic
948652158 2:239454776-239454798 CCCTGCTCTCAATGGGCCCTGGG + Intergenic
948910237 2:240999060-240999082 CCCCGGGCTCGCGGGGCGCCCGG + Intronic
948934009 2:241150573-241150595 CCCCCCGCCCGCTGGGCCCTTGG - Intronic
1169914636 20:10673387-10673409 CCCTCCCCTCGCGGCGCCCTGGG - Intronic
1172676714 20:36677474-36677496 CCCTGCGCTGGCTGAGCCCAAGG - Intronic
1172765130 20:37346743-37346765 CCCTGCCCTCGTGGGGCCTCGGG + Intronic
1174204508 20:48828579-48828601 CCGGGCCCTCGCGGTGCCCTCGG + Intergenic
1175036551 20:56005480-56005502 CCCTGAGCTCGCCAGGCCCCAGG - Intergenic
1175981177 20:62739442-62739464 CCCTGGGCTCAGGGGGCCCCAGG - Intronic
1175990363 20:62785537-62785559 CCCTGCGCTGGGTGGGCCCTGGG + Intergenic
1176194686 20:63831573-63831595 CCCTGGGCTGGCGGGGGGCTGGG + Intergenic
1178561551 21:33643040-33643062 CCCTCCTCTCGCGGGGACCCCGG + Intronic
1178707863 21:34889642-34889664 CCGTGCGCTCGAGCGGCCCCAGG + Intronic
1178961995 21:37073611-37073633 CCCTTCGCGAGCGAGGCCCTGGG + Intronic
1179882815 21:44300488-44300510 CCCTCCGCTCGCGTGGCCTCGGG - Intronic
1180092542 21:45540399-45540421 CCCAGGGCTCCCGGGCCCCTGGG - Intronic
1180145231 21:45915046-45915068 CCCTGAGCACACGGGACCCTGGG - Intronic
1180961301 22:19763579-19763601 CCCTGGGCTGGTGTGGCCCTAGG + Intronic
1181082795 22:20425594-20425616 CCCTGGGCGCGCAGGGCCCCAGG - Exonic
1183058697 22:35322332-35322354 CCCTGCCCCCGCGGAGGCCTGGG - Intronic
1184388222 22:44188200-44188222 CCCTGCCCTCGGGCTGCCCTAGG + Intronic
1184663452 22:45976056-45976078 CCCCGCCCGCCCGGGGCCCTGGG - Intronic
1184669936 22:46007190-46007212 CCCTGCGCTGGGCGGGCCCTAGG - Intergenic
1184796829 22:46737875-46737897 GCCTGCGCTCCCAGGGCCCCCGG + Intronic
951508990 3:23480380-23480402 CCCTGCACTCTTGGGGGCCTAGG - Intronic
953353179 3:42231224-42231246 CCCTGCTCTTGGGGGGCCCTAGG - Intergenic
953705227 3:45225841-45225863 CCGGGCGCTCGGGGGGCCCGGGG + Exonic
954149528 3:48650479-48650501 CCCTGTCCCCGGGGGGCCCTGGG - Exonic
954795788 3:53160917-53160939 CCCTCCGCCCGCTGGGGCCTGGG - Intronic
957156398 3:76550629-76550651 CCCTGCACTCTCAGGGGCCTGGG + Intronic
957665427 3:83218933-83218955 CCCTGTGCTCTCAGGGTCCTGGG - Intergenic
959476668 3:106820996-106821018 CCCTGTGCTCTCGGGGGCCCAGG + Intergenic
961390686 3:126550744-126550766 CCCTGCTGTGGCTGGGCCCTGGG + Intronic
963250092 3:143095349-143095371 CCCTGTGCTCTCAGGGGCCTGGG + Intergenic
963906204 3:150775098-150775120 CCCTGCGCTCTCGGGGGCCCAGG - Intergenic
966983679 3:185160788-185160810 CTCTGAGCGCACGGGGCCCTGGG - Intergenic
967858342 3:194134541-194134563 CCCTCTCCCCGCGGGGCCCTGGG - Intergenic
967924028 3:194632816-194632838 CCCAGGGCTCGCGGTGTCCTCGG + Intronic
968674695 4:1871273-1871295 TGCCGCGCTCGCGGGGCCCGCGG - Intergenic
968727672 4:2255830-2255852 CCATGCCCTCTCGGTGCCCTGGG - Intronic
968756468 4:2418669-2418691 CCCGGGGCTCGCGGCGCCCTAGG - Intergenic
969619033 4:8269775-8269797 CCCTGCGCTCCCTGCGCCCTGGG + Exonic
974023340 4:56711158-56711180 CCCTGTGCTCTTGGGGGCCTGGG + Intergenic
974514919 4:62896996-62897018 TCCTGCGCTCTAGGGGGCCTGGG + Intergenic
975373930 4:73620452-73620474 CCCTGCGCCCGCGCGGGCCTCGG - Exonic
975597841 4:76066936-76066958 CCCTGCACTCTTGGGGGCCTGGG - Intronic
982033626 4:151325247-151325269 CCGTGCGCTCTCGGGCCACTCGG - Intronic
982126663 4:152189716-152189738 CCCTGTGCTCACTGGGCCCCTGG + Intergenic
984296552 4:177861653-177861675 CCCTGTGCTCTCGGGGGCCCAGG + Intronic
985448119 4:190038597-190038619 CCCTGCCCGCGCTGGTCCCTGGG + Intergenic
985467571 5:12289-12311 CTCCGCCCTCGCGGTGCCCTGGG + Intergenic
988346284 5:30041864-30041886 CCCTGCACTCTAGGGGACCTGGG + Intergenic
990910059 5:60843952-60843974 CCCTGGGCTCGGGAGGCGCTTGG - Intronic
994753318 5:103764748-103764770 CCCTGCCCTCTCAGGGGCCTGGG - Intergenic
997212166 5:132083245-132083267 CCCTGCCCTCTCTGGGCCTTGGG - Intergenic
1003872281 6:10412656-10412678 CCGGGCGCTCGTGGGGCTCTCGG + Intronic
1004044568 6:12012080-12012102 CCCTGGGGCCGCGGGGCCCGGGG - Intronic
1005526904 6:26659853-26659875 GCCTGCGCTCTGGGAGCCCTCGG + Intergenic
1006463898 6:34179509-34179531 CCCTGTGCTCTCAGGGCCCTGGG - Intergenic
1007557903 6:42782435-42782457 CCCAGCGCTGCCGGGGCCCCGGG + Intronic
1008188307 6:48422879-48422901 CCCTGCTCTGGCGGAGCCCAGGG + Intergenic
1008475782 6:51934278-51934300 CCCTGAGCTCGATGGGTCCTGGG + Exonic
1010887693 6:81263897-81263919 CCCTGTGCTCTTGGGGGCCTGGG - Intergenic
1011930244 6:92701802-92701824 CCCTGCACTCTTGGGGCCCCAGG - Intergenic
1012133053 6:95519972-95519994 CCCCGCACTCTCGGGGCCCCAGG - Intergenic
1013772778 6:113646109-113646131 TCCTGCGGTCAGGGGGCCCTTGG + Intergenic
1014272538 6:119349849-119349871 CCCCGCCCCCGCGGGACCCTGGG - Intergenic
1014505422 6:122248423-122248445 CCCTGTGCTCTTGGGGCCCCAGG - Intergenic
1014813745 6:125912531-125912553 CCCTGAGCTCTGGGGGCCCACGG + Intronic
1018091333 6:160348659-160348681 CGCGGCGCTCGGGGGGCTCTGGG - Exonic
1018419682 6:163630905-163630927 CCCCGCGCTCCTGGGGGCCTGGG + Intergenic
1019339217 7:500650-500672 CCCTGCTATGGCTGGGCCCTGGG - Intronic
1019701242 7:2475884-2475906 CCCTCCCCTCGCTGGGCCTTGGG - Intronic
1021097159 7:16547525-16547547 CCCTGCACTCTCGGGGACCCAGG + Intronic
1026938935 7:74275520-74275542 ACCTGCGCTCGGCGTGCCCTTGG - Intergenic
1028527500 7:91801759-91801781 CTCTGCACTCTCGGGGGCCTGGG - Intronic
1029609304 7:101618233-101618255 CCCTGCCCTCGCTGCACCCTGGG - Intronic
1030721854 7:112881037-112881059 CCCTGCGCTCTTGGGGGCCTGGG + Intronic
1035212265 7:157337178-157337200 CCGGGCGCGCGCGGGGCCCTAGG - Intronic
1035266753 7:157693508-157693530 CGCTGCGGTCGCAGGGCCTTGGG + Intronic
1037262782 8:17027133-17027155 CCCTACACTCGCGCGGCCCCGGG - Intergenic
1039911130 8:41828080-41828102 CCCTGAGCGCTCGCGGCCCTGGG - Intronic
1042532905 8:69833131-69833153 GCCTGGGCTCGCGGCACCCTCGG + Exonic
1042591430 8:70402598-70402620 CCCGGCCCTCTCGGGCCCCTGGG - Intronic
1042625001 8:70748312-70748334 CCCTGCACTCGCAGGGGCCCAGG + Intronic
1043735107 8:83731340-83731362 CTCTGCGCTCTCCGGGGCCTGGG - Intergenic
1045300830 8:100908554-100908576 CCCTGTGCTCTCGGGGGCCCCGG - Intergenic
1046407368 8:113791305-113791327 CCCTGCACTCTTGGGGGCCTGGG - Intergenic
1047226559 8:122960075-122960097 CCCTGCCCTCATGGAGCCCTTGG + Intronic
1047274581 8:123396108-123396130 CCCGGCGCTCGGAGGGGCCTGGG - Intronic
1048238448 8:132716134-132716156 CCCTGCACTCTTGGGGGCCTTGG + Intronic
1049465241 8:142748285-142748307 CACTGCACTGGTGGGGCCCTGGG + Intergenic
1049786802 8:144454770-144454792 CCCTGCACACGTGGGGCCCTGGG + Intronic
1052597033 9:30574602-30574624 CCCTGTGCTCTTGGGGGCCTGGG + Intergenic
1052708027 9:32016503-32016525 CCCTGCACTCTCAGGGGCCTGGG - Intergenic
1058153319 9:101486100-101486122 CACTGCGCTCGCGGTGTCTTGGG - Intronic
1059418967 9:114179251-114179273 CCCTGTGCTCCCTGGGCCCAGGG + Intronic
1060268599 9:122126405-122126427 CCCTGCGTTCCTGGGTCCCTGGG - Intergenic
1061216503 9:129224821-129224843 CCCTCCGCTCCCTGGGCCCAGGG + Intergenic
1061913958 9:133739453-133739475 CCCTGCCCTCGAGGGGCTCAGGG + Intronic
1062033035 9:134370668-134370690 CCGTGTGCTGGCTGGGCCCTGGG + Intronic
1062453027 9:136623418-136623440 CTCGGTGCTCCCGGGGCCCTGGG + Intergenic
1062580185 9:137225933-137225955 CCCTCCGCCCGCGGGGCGCGGGG + Exonic
1062696478 9:137878438-137878460 CCCTCCGCACGCCGGGTCCTGGG + Intronic
1186877804 X:13833933-13833955 GCCTGCCCTCTCAGGGCCCTGGG - Intronic
1188434788 X:30148164-30148186 CCCTGCGCTCTCGGGGACCCAGG + Intergenic
1188647777 X:32591797-32591819 TCCTGCGCTCTTGGGGGCCTGGG + Intronic
1191016258 X:55813402-55813424 CCCTGCACTCTCAGGGGCCTGGG + Intergenic
1192178323 X:68899556-68899578 CCCTGACCTGGCAGGGCCCTTGG + Intergenic
1197526797 X:127574830-127574852 CCCTGTGCTCTCGGGGGCCTGGG + Intergenic
1199861164 X:151801453-151801475 CCCTGCACTCTTGGGGGCCTGGG - Intergenic
1200000856 X:153059065-153059087 CACTGGGCTCCCGGGGCCTTAGG - Intronic