ID: 1142422864

View in Genome Browser
Species Human (GRCh38)
Location 16:89983316-89983338
Sequence CCAGACAAAAAGGCCTTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142422864_1142422874 27 Left 1142422864 16:89983316-89983338 CCACCCAAGGCCTTTTTGTCTGG No data
Right 1142422874 16:89983366-89983388 AGGTCCCTGATGACTCCTTATGG No data
1142422864_1142422875 28 Left 1142422864 16:89983316-89983338 CCACCCAAGGCCTTTTTGTCTGG No data
Right 1142422875 16:89983367-89983389 GGTCCCTGATGACTCCTTATGGG No data
1142422864_1142422872 7 Left 1142422864 16:89983316-89983338 CCACCCAAGGCCTTTTTGTCTGG No data
Right 1142422872 16:89983346-89983368 GCACACACCTGTCTTCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142422864 Original CRISPR CCAGACAAAAAGGCCTTGGG TGG (reversed) Intergenic
No off target data available for this crispr