ID: 1142424165

View in Genome Browser
Species Human (GRCh38)
Location 16:89992113-89992135
Sequence CGTGGTCACAGCTTGATGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142424165_1142424175 25 Left 1142424165 16:89992113-89992135 CCCAGCATCAAGCTGTGACCACG No data
Right 1142424175 16:89992161-89992183 CAGGAGAGACTTGGTTCCCAGGG No data
1142424165_1142424173 16 Left 1142424165 16:89992113-89992135 CCCAGCATCAAGCTGTGACCACG No data
Right 1142424173 16:89992152-89992174 CAGGAAGCTCAGGAGAGACTTGG No data
1142424165_1142424168 -3 Left 1142424165 16:89992113-89992135 CCCAGCATCAAGCTGTGACCACG No data
Right 1142424168 16:89992133-89992155 ACGCCTGCCTGATGTTGACCAGG No data
1142424165_1142424174 24 Left 1142424165 16:89992113-89992135 CCCAGCATCAAGCTGTGACCACG No data
Right 1142424174 16:89992160-89992182 TCAGGAGAGACTTGGTTCCCAGG No data
1142424165_1142424171 6 Left 1142424165 16:89992113-89992135 CCCAGCATCAAGCTGTGACCACG No data
Right 1142424171 16:89992142-89992164 TGATGTTGACCAGGAAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142424165 Original CRISPR CGTGGTCACAGCTTGATGCT GGG (reversed) Intergenic
No off target data available for this crispr