ID: 1142425788

View in Genome Browser
Species Human (GRCh38)
Location 16:90001599-90001621
Sequence TTATTAGGAAGGCCCCTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142425783_1142425788 2 Left 1142425783 16:90001574-90001596 CCTGGGGTTGGGTAGCTCCTAAT 0: 1
1: 0
2: 0
3: 10
4: 75
Right 1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
1142425776_1142425788 28 Left 1142425776 16:90001548-90001570 CCTGGTACCTGTTCGTGAACACT 0: 1
1: 0
2: 0
3: 7
4: 74
Right 1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
1142425777_1142425788 21 Left 1142425777 16:90001555-90001577 CCTGTTCGTGAACACTTTTCCTG 0: 1
1: 0
2: 0
3: 5
4: 104
Right 1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103
1142425775_1142425788 29 Left 1142425775 16:90001547-90001569 CCCTGGTACCTGTTCGTGAACAC 0: 1
1: 0
2: 0
3: 6
4: 55
Right 1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142425788 Original CRISPR TTATTAGGAAGGCCCCTTCT GGG Intergenic
901497930 1:9632808-9632830 TTCTTGGGAAGGCGGCTTCTAGG + Intergenic
902710427 1:18235776-18235798 TTATTAAAAAGGTCACTTCTGGG + Intronic
907873735 1:58466158-58466180 TAATGAGGAAGGGCCCTTCCTGG + Intronic
907955145 1:59221088-59221110 TTTTCAGAAAGGCCCTTTCTGGG + Intergenic
913557745 1:119985462-119985484 TAATTAGGAAGGCCTGCTCTTGG - Intronic
924114861 1:240735258-240735280 TTATTAGTCAGGCCCCTCCAGGG - Intergenic
1068958552 10:62843978-62844000 TTATTACTAAGCCCCCTTTTAGG - Intronic
1069314693 10:67082672-67082694 TTAGGAGAAAGGGCCCTTCTTGG - Intronic
1074328699 10:112480578-112480600 TTTTGAGGAAGGCACCCTCTGGG + Intronic
1074424987 10:113342841-113342863 TGATTATGAAGGCCTCTTCCAGG + Intergenic
1077840246 11:5966510-5966532 TTAGTAGCTAGGCCCCTTTTTGG - Intergenic
1078268681 11:9774597-9774619 ATCCTAGGAAGGCCCATTCTTGG + Intergenic
1078933942 11:15936060-15936082 CTATTGGGAAGCCCCCTTCATGG - Intergenic
1086401095 11:86461466-86461488 TTTTTAGGAAGTGCCCTTGTGGG + Intronic
1089632788 11:119794030-119794052 TTATTAGGAAGGACCAGTATTGG + Intergenic
1089789323 11:120931258-120931280 TTATTAGGAGGGCCCCTGCAGGG + Intronic
1092576324 12:9787140-9787162 TTGTTAGGAAGGCTCATTCTAGG - Intergenic
1095266226 12:40161223-40161245 TTATTAGGAAAGCTCATTTTTGG + Intergenic
1095570433 12:43677929-43677951 TTATTTGGGAGGTCCCTTGTAGG - Intergenic
1098386752 12:69927716-69927738 TTTTTATGAACGGCCCTTCTTGG - Intronic
1105825354 13:24117621-24117643 ATTTTAGGAAGGCTCCTTTTGGG - Intronic
1106695052 13:32163988-32164010 TTATTAAAAAGGTCCCTTCATGG - Intronic
1107594901 13:41952973-41952995 GTGTTAGGAAGCCTCCTTCTGGG + Intronic
1107653490 13:42568590-42568612 TTATTAGGGAGGCCGGTCCTAGG + Intronic
1108472670 13:50783274-50783296 TTATTTGGAAGGCCATCTCTGGG - Intronic
1130822016 15:87505924-87505946 TTCTTAGGAAGCCACCTTTTTGG - Intergenic
1142425788 16:90001599-90001621 TTATTAGGAAGGCCCCTTCTGGG + Intergenic
1146619167 17:34383383-34383405 TTGTTAGAAAGGCCAATTCTTGG + Intergenic
1148978151 17:51547619-51547641 TCACTACAAAGGCCCCTTCTTGG + Intergenic
1158200899 18:54939442-54939464 TTGTTAGAAAGGCCGCATCTAGG - Intronic
1159097122 18:63916426-63916448 TTCTGAGGAAGTCACCTTCTTGG - Intronic
1159237925 18:65701437-65701459 TAATAAGGAAGGCGCCTTCATGG + Intergenic
925967057 2:9075892-9075914 GTATGGGGAAGGACCCTTCTGGG - Intergenic
926353555 2:12019552-12019574 TTCTTCTGAAGGCCCTTTCTGGG + Intergenic
929941218 2:46335560-46335582 TTATTACCCAGCCCCCTTCTTGG + Intronic
932510357 2:72281053-72281075 ATTTTAGCAAGGCTCCTTCTAGG - Intronic
938659963 2:133476171-133476193 TTCTTAGGAAAGACCCTTCAGGG - Intronic
940175716 2:150875562-150875584 TTGTTAGAAATGCCCATTCTTGG - Intergenic
940184357 2:150966917-150966939 TGTTTATGAAGGCCCCTCCTTGG + Intergenic
941688666 2:168474892-168474914 TTATTAGGAAGCCCCATACAAGG - Intronic
943488045 2:188513542-188513564 TTTTTAAGAAAGCCACTTCTTGG + Intronic
945925083 2:215795097-215795119 TGTGCAGGAAGGCCCCTTCTTGG - Intergenic
946685581 2:222266278-222266300 TTCCTAGGAAAGCCCCCTCTGGG + Intronic
948310644 2:236983246-236983268 TTTCTTGGAATGCCCCTTCTTGG - Intergenic
1169002214 20:2176365-2176387 TTGTTAGAAAGGCCAGTTCTTGG - Intronic
1170079847 20:12462435-12462457 TTTTTAAGAAGTCACCTTCTCGG - Intergenic
1175472021 20:59237105-59237127 TTATTATGAAGGTTCTTTCTGGG - Intronic
1176718539 21:10374770-10374792 TCATCAGGAAGGCGCCATCTTGG + Intergenic
1177971521 21:27796153-27796175 TTCTTAGGAAGCTCCCTCCTAGG + Intergenic
1178013354 21:28313317-28313339 CTATTAGGAAGTCTCCTTATTGG + Intergenic
1180299840 22:11028544-11028566 TCATCAGGAAGGCGCCATCTTGG - Intergenic
1181821239 22:25477296-25477318 TTATTAGGAATGACACATCTGGG - Intergenic
949287415 3:2423137-2423159 TTCTTAGGAACACCACTTCTAGG - Intronic
952601383 3:35087964-35087986 TTTTTAGGAAGACATCTTCTTGG - Intergenic
953344404 3:42163265-42163287 TTGTTAGAAATGCACCTTCTTGG + Intronic
953588153 3:44223771-44223793 TTATTAGAAAGGCAAATTCTTGG - Intergenic
956002180 3:64741214-64741236 TTTTTAGGAAGGCACATTTTTGG + Intergenic
959837400 3:110936234-110936256 TTATTAGGTAGGACCCACCTAGG - Intergenic
967242262 3:187451581-187451603 TTATTAGGATGGCCACTTCAGGG - Intergenic
968463800 4:739622-739644 TTTTTGGGAAGCCCGCTTCTGGG + Intronic
969967342 4:11010913-11010935 TTATTTGAAAGGCCCTTCCTGGG + Intergenic
974736758 4:65945664-65945686 TGATAAAGAAGGCCCCTTATTGG + Intergenic
974862992 4:67545786-67545808 TTATTAGGAAGGCACGATCCTGG + Intergenic
975414044 4:74087628-74087650 TTGTTGGGAATGCCCCTTGTTGG + Intergenic
975414049 4:74087644-74087666 TTGTTGGGAATGCCCCTTGTTGG + Intergenic
979808911 4:125011390-125011412 ATGTAAGGAAGGCCCCATCTAGG - Intergenic
982576595 4:157119034-157119056 TTTTTAGAAAGGCACTTTCTTGG - Intronic
988522742 5:31961096-31961118 TTATCAGGAATTCCCCTTTTGGG + Intronic
991277866 5:64872026-64872048 TTATCAGGAAGGCCACATTTAGG + Intronic
995623595 5:114054399-114054421 TTAATTGGAAGTCCCATTCTAGG + Intergenic
997021433 5:130007482-130007504 TTAGTAGCAAGACCCATTCTTGG + Intronic
997676449 5:135716657-135716679 TTATTTGGAAGACTCCTTGTTGG - Intergenic
999201551 5:149820360-149820382 TTATTGAGAGGGCCCCTGCTTGG + Intronic
999764172 5:154725803-154725825 TTATTAGGGACACTCCTTCTTGG - Intronic
1001794445 5:174490383-174490405 TTGTTAGGAAGGCTCTTCCTTGG - Intergenic
1003616696 6:7660872-7660894 TTGTTTGGGAGCCCCCTTCTGGG - Intergenic
1008489745 6:52074041-52074063 TTATTTGGAAGGCACATACTTGG - Intronic
1010914576 6:81599958-81599980 TTACTAGAAAGGCCAGTTCTTGG + Intronic
1012903362 6:105034257-105034279 TTATTATGAATGACACTTCTTGG - Intronic
1013148147 6:107415416-107415438 GTACTAGTAAGGCCTCTTCTAGG + Intronic
1018690202 6:166338563-166338585 TTTTCAGGAATGCCCCTTCCTGG - Intronic
1019378349 7:708175-708197 GTATTGGGATGGCTCCTTCTGGG - Intronic
1019378365 7:708254-708276 GTATTGGGATGGCTCCTTCTGGG - Intronic
1021316263 7:19151140-19151162 TTATTAGCAATTCCACTTCTGGG - Intergenic
1023963941 7:44951752-44951774 TTATTAGGAAGGAGCCCTCATGG + Intergenic
1024484662 7:49904521-49904543 TTATTAGGAATGCTGCTTATAGG + Intronic
1026157889 7:67843189-67843211 TTAGTAGGAAGCCCCATACTGGG + Intergenic
1026277594 7:68893774-68893796 TTATTAGACATGACCCTTCTCGG - Intergenic
1027971551 7:85089361-85089383 TTATTAGAAAAGACCTTTCTGGG - Intronic
1030137974 7:106276282-106276304 TTATTTGAAAGGCCATTTCTAGG - Intronic
1030225605 7:107146875-107146897 TTTTTAGAAATGCCCATTCTGGG + Intronic
1033176840 7:139132541-139132563 TCACTAGGAAGGCCCCTTCCTGG - Intergenic
1033421162 7:141205726-141205748 ATATTAAGCAGGGCCCTTCTAGG - Intronic
1034590674 7:152136424-152136446 TTCATAGGAAGGCCCCTGCCCGG + Exonic
1038117799 8:24577510-24577532 TTAGAAGGAAGGCCCCATCTGGG - Intergenic
1038538749 8:28373721-28373743 GTATTGGGAAGGGCTCTTCTGGG - Intronic
1041751110 8:61261719-61261741 TTCTTATGAGGGCCCCTTCCTGG - Intronic
1042206557 8:66335418-66335440 TTTTTAGGAAAGCCTTTTCTTGG - Intergenic
1043162165 8:76859226-76859248 TTACTAAGAAGGCCCTTTCAAGG + Intronic
1049457232 8:142699930-142699952 TTACTAGTAAGGCCCCTGCCTGG - Intergenic
1053471248 9:38347271-38347293 TTAACAAGAGGGCCCCTTCTGGG - Intergenic
1055185448 9:73447025-73447047 TTATTAAGAAGGGCCATACTGGG - Intergenic
1055692853 9:78852232-78852254 TTGTTAGGATGTCCCTTTCTTGG + Intergenic
1057547445 9:96028596-96028618 TTATTAGGGACGCCCTTACTAGG - Intergenic
1186404545 X:9290427-9290449 TTATTAGAAATGCACATTCTTGG - Intergenic
1190949921 X:55133427-55133449 TTAGGAGGAAGGTCCCTTCAGGG + Intronic
1192245894 X:69371320-69371342 TTACTAGGAAAGCCCCTGCCAGG - Intergenic
1196428549 X:115597464-115597486 TTATTAGGTAGGCAGCTACTTGG + Intronic
1201310902 Y:12597482-12597504 CTCTTAGGAAGGCACTTTCTGGG + Intergenic