ID: 1142427930

View in Genome Browser
Species Human (GRCh38)
Location 16:90010737-90010759
Sequence GGAGGGGCTGAGGGGATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 807
Summary {0: 1, 1: 3, 2: 3, 3: 76, 4: 724}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142427930_1142427938 2 Left 1142427930 16:90010737-90010759 CCACAGATCCCCTCAGCCCCTCC 0: 1
1: 3
2: 3
3: 76
4: 724
Right 1142427938 16:90010762-90010784 AGCTGCTCACCCTCTCATCCAGG 0: 1
1: 0
2: 1
3: 25
4: 427
1142427930_1142427943 20 Left 1142427930 16:90010737-90010759 CCACAGATCCCCTCAGCCCCTCC 0: 1
1: 3
2: 3
3: 76
4: 724
Right 1142427943 16:90010780-90010802 CCAGGGCCACGCCGTCCTAGCGG 0: 1
1: 0
2: 2
3: 8
4: 91
1142427930_1142427939 3 Left 1142427930 16:90010737-90010759 CCACAGATCCCCTCAGCCCCTCC 0: 1
1: 3
2: 3
3: 76
4: 724
Right 1142427939 16:90010763-90010785 GCTGCTCACCCTCTCATCCAGGG 0: 1
1: 0
2: 0
3: 15
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142427930 Original CRISPR GGAGGGGCTGAGGGGATCTG TGG (reversed) Intronic
900171107 1:1269286-1269308 GGTGTGGCTGAGGGGCTTTGGGG - Intronic
900183828 1:1324065-1324087 TGAGGGGCTGAGGGGCTGGGAGG + Intronic
900192308 1:1356630-1356652 GGAGGGGCTGAGGGGGAGTGGGG + Intronic
900270316 1:1783655-1783677 GGAGGGGCTGCTGGGTTCTCTGG + Intergenic
900321296 1:2085575-2085597 GGAGGGGCTGAGGATATGGGGGG + Intronic
900321311 1:2085630-2085652 GGAGGGGCTGAGGACGTCGGGGG + Intronic
900321327 1:2085686-2085708 GGAGGGGCTGAGGACGTCGGGGG + Intronic
900321343 1:2085742-2085764 GGAGGGGCTGAGGACGTCGGGGG + Intronic
900321360 1:2085798-2085820 GGAGGGGCTGAGGATATGGGGGG + Intronic
900345877 1:2210035-2210057 GGGGGTCCTGAGGGGAGCTGGGG + Intronic
900401281 1:2473946-2473968 GGAGGGGCCGAGGCGGCCTGGGG + Intronic
900507534 1:3037193-3037215 GGAGGGGTGGGTGGGATCTGAGG - Intergenic
900625805 1:3608020-3608042 GGCGGGGGTGAGGGGAGTTGGGG + Intronic
900918128 1:5652547-5652569 TGAGGAGCTGCGGGGACCTGAGG - Intergenic
900951081 1:5858606-5858628 TGAGGGTCTGAGGGGAGCAGGGG - Intergenic
901156833 1:7145844-7145866 GAGTGGGCTGAGGGGATCTTGGG + Intronic
901443576 1:9293410-9293432 GGAGGGGCTGGGGCGCTCCGGGG + Intronic
901667449 1:10834898-10834920 GGTGGGGCTCAGGGGCTCAGTGG - Intergenic
901733270 1:11295701-11295723 GGAAGTGCTGAGGGGGTCAGAGG + Intronic
902323336 1:15683617-15683639 GGAGGGTCTCAGGGTCTCTGGGG + Intergenic
902372074 1:16013424-16013446 GGAGGAGGGGAGGGGATCAGAGG - Intergenic
902388454 1:16089098-16089120 CGAGTCGCTGAGGGGAACTGAGG - Intergenic
902406236 1:16185092-16185114 GGAGGGGATAATAGGATCTGGGG + Intergenic
902501545 1:16914473-16914495 GGAGCTGCAGAGGGCATCTGCGG - Intronic
903044398 1:20554232-20554254 GGAGGGAATGAGGAGGTCTGTGG - Exonic
903545716 1:24122199-24122221 GGAGGGACAGAGGAGCTCTGAGG - Intronic
903969052 1:27107257-27107279 GGAGGGGCTGGGTGTATATGTGG - Intronic
904005275 1:27360352-27360374 GCAGGGGCTGAGAGAACCTGAGG + Exonic
904421724 1:30398462-30398484 GAGGGGGCTGAGGTGACCTGGGG + Intergenic
904467069 1:30714435-30714457 TGAGGGGCTTAAGGGACCTGAGG + Intronic
904495064 1:30881915-30881937 GCAGGGGGTGAGGGCAGCTGCGG - Intronic
904772830 1:32890374-32890396 GGCTGGGCTGAGGGGATGGGTGG - Intronic
904838528 1:33355082-33355104 GGAGAGACTGAGGCGAGCTGGGG + Exonic
905106889 1:35568854-35568876 GGAGGGACTGAGATCATCTGGGG + Intergenic
905172880 1:36119473-36119495 GGAGGGACTGAGGGGGTGCGGGG - Intronic
906033834 1:42738942-42738964 GGAAGAGCTGGGGGTATCTGAGG + Intronic
906646406 1:47478395-47478417 GGAGGGGCTCACAGGCTCTGGGG + Intergenic
907071296 1:51537647-51537669 CCAGGGGCTGAGGTGATCTCAGG - Intergenic
909197732 1:72648673-72648695 GGGGAGGCTGAGGGGAGTTGAGG + Intergenic
912440227 1:109691980-109692002 GGAGGGGTGGAGGAGAGCTGAGG + Intronic
912717225 1:111990865-111990887 GGAGGGACTGAGGGGCTGGGCGG - Intergenic
912741163 1:112198907-112198929 GTGGGGGCTGAGGGGATGGGAGG - Intergenic
913246837 1:116877496-116877518 GGAAGGGCTGGGAAGATCTGGGG + Intergenic
913961257 1:143339587-143339609 GGAGGGGCTGGCGGGGTCCGGGG + Intergenic
914055610 1:144165160-144165182 GGAGGGGCTGGCGGGGTCCGGGG + Intergenic
914123536 1:144801202-144801224 GGAGGGGCTGGCGGGGTCCGGGG - Intergenic
914713452 1:150235353-150235375 GCAGGGGCTGAGTGGGACTGGGG + Intronic
914730351 1:150364484-150364506 GGAGGGGCTGCGGGTCTCGGAGG - Intronic
914900763 1:151709946-151709968 TGAAGGCCTGAGGGGATCAGAGG + Intronic
915019800 1:152768531-152768553 GAAGGGGCTGAGAGGCTGTGGGG + Intronic
915446192 1:155976263-155976285 GGAGGGGGAGAGGGGATCCAGGG + Intronic
915888148 1:159745370-159745392 GGAGGGGCTGAGGGGGTATGTGG + Intergenic
915984147 1:160446696-160446718 TTATGGGCTGAGGGGATCTTAGG + Intergenic
916239063 1:162621306-162621328 GGAGAGACTGATGGGTTCTGGGG + Intergenic
916481839 1:165221362-165221384 GGAGGGTCTGAGGAGATATGGGG - Intronic
917924348 1:179776554-179776576 GGCAGGGCTGAGGGGATAAGTGG - Intronic
917931110 1:179823488-179823510 GGAGGGGCTGAGTGCAGGTGTGG - Intergenic
918373160 1:183881865-183881887 GGAGGCCCTGAAGGGAGCTGAGG - Intronic
918567910 1:185953131-185953153 GAAGGGGTTGAGGGGTACTGAGG + Intronic
918880348 1:190111363-190111385 TGAGGGGCAAAGGGAATCTGAGG + Intronic
919882884 1:201912391-201912413 GGAGGGAGTGAAGGGAGCTGTGG - Intronic
920186300 1:204161440-204161462 GGAGGGGCTCAGGGGACCTTGGG + Intronic
920412053 1:205769833-205769855 GGAGGGGGTCTGGGCATCTGTGG - Exonic
920910578 1:210212811-210212833 GGAGTGAAAGAGGGGATCTGGGG - Intergenic
921057476 1:211554489-211554511 GGAGTAGCTGAGAGGGTCTGTGG - Intergenic
921167429 1:212517076-212517098 GCAGGGGCTGTGGGAGTCTGAGG - Intergenic
921814681 1:219550169-219550191 GGAGGGGGATAGGGGAGCTGGGG - Intergenic
923125246 1:231028816-231028838 GGAGGGGTGGAGGGGAGCTCTGG - Intronic
923199071 1:231694335-231694357 GGAGGGGTTGGGGGGACCTCAGG - Exonic
923801748 1:237216950-237216972 GGAGGAGCTGGAGTGATCTGGGG - Intronic
924948545 1:248862756-248862778 GGCTGGGCTGAGGGTGTCTGTGG - Intergenic
1062817007 10:508257-508279 GGAGTGGGTGAGGGGCTCTGGGG - Intronic
1063202958 10:3802330-3802352 GGAGGGGTTGAGCGGAACTTCGG - Intergenic
1063377499 10:5562705-5562727 GGAGTGAGTGAGGGTATCTGAGG + Intergenic
1063546749 10:6988790-6988812 GGAGGGGTAGACGTGATCTGGGG + Intergenic
1063583881 10:7333762-7333784 GGAGGCCCTGTGGGGAGCTGGGG - Intronic
1063592938 10:7409945-7409967 GAAGGGGCTGGAGGGAGCTGGGG - Intronic
1063641175 10:7832188-7832210 GCAGGGGATGTGGGGATGTGGGG - Intronic
1064791432 10:18960944-18960966 GGAGGGCCTGAGGAGATGTCTGG - Intergenic
1065684534 10:28270537-28270559 GGGGGGGAGGAGGGGAGCTGGGG + Intronic
1067022891 10:42817503-42817525 CAAGGGGCTGAGAGGAACTGAGG - Intronic
1067029709 10:42871986-42872008 GGAGGGGCTGGCGGGGTCAGGGG + Intergenic
1067095042 10:43294611-43294633 GGAGGGGGTGAGAGGATCCCAGG - Intergenic
1067095107 10:43294796-43294818 GGAGGGGGTGAGGTGTTCAGAGG - Intergenic
1067160363 10:43820026-43820048 AGATGGGCGGAGGGGCTCTGCGG + Intergenic
1067174135 10:43930627-43930649 GGAGGGAATGAGGAGATGTGAGG + Intergenic
1067227466 10:44385235-44385257 GGAGGGGCGAAGGGGATGGGTGG - Intronic
1067234679 10:44437615-44437637 GGAGGAGCTGATGGGCCCTGGGG + Intergenic
1067750788 10:48969779-48969801 GGAGGGGCTGGGGAGAGCTTGGG - Intronic
1067760423 10:49040882-49040904 AGAGGGGCTGGGGAGCTCTGTGG + Intronic
1067897036 10:50193626-50193648 TGAGGGGATGAGGGGTGCTGGGG + Intronic
1067951937 10:50748414-50748436 TGAGGGGATGAGGGGTGCTGGGG - Intronic
1068940760 10:62678597-62678619 GGAGGGCCTGAGAGGGTGTGAGG - Intergenic
1069158008 10:65053767-65053789 TGAGGGGCTGAGGGGATGAGGGG - Intergenic
1069743557 10:70700550-70700572 GGAGGAGCTGAGGGGAGTGGTGG + Intronic
1069752093 10:70751462-70751484 GGAGAGCCTGAGGGGAGATGGGG - Exonic
1070806367 10:79273309-79273331 GGAGGGGCTGTTGGGAGCAGAGG - Intronic
1071044920 10:81361923-81361945 GGCGGGGGTGAGGGGGGCTGCGG - Intergenic
1071278116 10:84075248-84075270 GGATGGAATGAGGGGCTCTGTGG + Intergenic
1071397570 10:85238564-85238586 GGAGGAGGTGAGGGGCCCTGTGG + Intergenic
1071492060 10:86142973-86142995 GGAGGTGCAGAGGAGCTCTGAGG - Intronic
1071499555 10:86193684-86193706 GGATGGGCTGATGTGAGCTGAGG - Intronic
1071501643 10:86208324-86208346 GGAGGGGGCCAGGGCATCTGGGG - Intronic
1072442513 10:95469625-95469647 GGGGTGGGTGAGGGGCTCTGTGG - Intronic
1073073433 10:100808972-100808994 GGTGGGGCAGAGGGGAGATGCGG - Intronic
1073099906 10:101000862-101000884 GCAGGAGCTGCGGGGAGCTGGGG - Exonic
1073432485 10:103495123-103495145 GAGGGTGCTGAGTGGATCTGGGG - Intronic
1073822972 10:107286401-107286423 TAAGGGGCTGAGGGGAGGTGGGG - Intergenic
1073862777 10:107766594-107766616 GGATGGGATGAGAGGAGCTGGGG - Intergenic
1075030682 10:119022858-119022880 GGAGGGGAAGCGGGGATATGAGG - Intergenic
1075630623 10:123998716-123998738 GGAGGGGCTGGGGTGAGCAGGGG - Intergenic
1075726061 10:124611511-124611533 GGAGGGGCTTAGGGGACAAGGGG + Intronic
1075810495 10:125221495-125221517 GGAGGGGCTGAGGGGCTGCAGGG - Intergenic
1076426068 10:130368450-130368472 GGAGGGACTGAGGGGGCCAGGGG + Intergenic
1076650165 10:131981966-131981988 GGCGGGGCCGGGCGGATCTGCGG + Intergenic
1076715515 10:132362015-132362037 GGAAGGGCTGAGCGGCCCTGAGG - Intronic
1076807556 10:132866625-132866647 GGAGAGGCTGGGGGGATGCGGGG - Intronic
1076828255 10:132981331-132981353 GGAGGGGCTCAGGGGTGCTCAGG + Intergenic
1076835979 10:133021182-133021204 GGAGGGGCTGACGGGAAGGGCGG - Intergenic
1077061343 11:619094-619116 GGGAGGGCTCAGGGGGTCTGGGG + Exonic
1077248375 11:1549912-1549934 GGAGGGGCTGGGGGCAGGTGGGG - Intergenic
1077253237 11:1569979-1570001 GGCAGGGATGAGGGCATCTGGGG - Intronic
1077327042 11:1968406-1968428 GGAGGGGCTGTGTGGGGCTGTGG + Intronic
1077349458 11:2085751-2085773 GGATGGCCAGAGGGGATCGGGGG + Intergenic
1077433185 11:2526147-2526169 GGAGGAGCTGGGGTGATCTGGGG + Intronic
1077506880 11:2933694-2933716 GGAGGGGGTGAGAGGAGCTAGGG - Intergenic
1078062445 11:8056696-8056718 GGAGTGTCTGAGGTGATGTGTGG + Intronic
1078538643 11:12195837-12195859 GGAGGGGGTGGTGGGAGCTGAGG + Intronic
1078552295 11:12289044-12289066 GGAGGGCCGGAGGGGATATGTGG + Intronic
1078558081 11:12347058-12347080 GGAGGGGCTGAGGGGCATGGAGG - Intronic
1078617701 11:12880797-12880819 GGAGGCGCTAAGGGGAGCTCTGG + Intronic
1078771539 11:14357285-14357307 GGTGGGGGTGAGGGGATAAGTGG - Intronic
1078881286 11:15451482-15451504 GGTGGGGTTCAGGGGATCTTAGG - Intergenic
1079064374 11:17276731-17276753 GGAGGGGCAGAGCGGAGCGGTGG + Intronic
1079080314 11:17409326-17409348 GGAGGGGGTGAGGGCAGCAGGGG - Intronic
1079364461 11:19797207-19797229 GGAGGGGTGGAGGGGAAGTGGGG - Intronic
1080386919 11:31815896-31815918 AGAGGGGCTGACAGGAACTGCGG + Intronic
1080542354 11:33280015-33280037 GGGGGAGCTGAGGGGAGGTGGGG + Intronic
1080626509 11:34035296-34035318 GGAGGTACTGAGGGGACTTGGGG - Intergenic
1080874232 11:36261935-36261957 GGAGGAGCTGAGGGTATCTAGGG - Intergenic
1081626693 11:44660129-44660151 TGAGGGGCTGAGGGGATCAGAGG - Intergenic
1082790432 11:57343075-57343097 GGAGGGGCTGAGGCTGTCTCTGG - Intronic
1083426822 11:62592310-62592332 GGAGGGACTACGGGGAGCTGGGG + Intergenic
1083578984 11:63813273-63813295 GGAAGGGCCGAGGGGACCCGGGG - Intergenic
1083726283 11:64630281-64630303 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1083726290 11:64630302-64630324 GGCGGGGCTAAGCGGCTCTGGGG - Intronic
1084091452 11:66881730-66881752 GGAGGTGATGAGGGGCTGTGAGG - Intronic
1084106598 11:66984694-66984716 GGAGGGACTGAGGGGGTCACAGG - Intergenic
1084143559 11:67250580-67250602 GGAGGGGCTGGGGGGAGAGGAGG + Exonic
1084171067 11:67401375-67401397 CGAGGCGCTGAGGGTAGCTGGGG - Intronic
1084180053 11:67441664-67441686 GGAGGGGCTGCTGGGATGTATGG + Intronic
1084452138 11:69245467-69245489 TGAGGGGCTGGGGGTGTCTGGGG + Intergenic
1084499214 11:69525029-69525051 TGAGGGGCTGGGGGGAACTGGGG + Intergenic
1084542001 11:69792664-69792686 GGAGGGGCTGTTGGGCTCTGGGG + Intergenic
1084677407 11:70643934-70643956 AGAGGGGCAGAGGAGATCTGGGG + Intronic
1084902679 11:72321560-72321582 GGCTGGGCTGAGTGGCTCTGCGG + Intronic
1085390015 11:76177529-76177551 CGAGGGGCTGGGGGGCTGTGGGG - Intergenic
1085401424 11:76238148-76238170 GGAGGGGAAGTGGGGAACTGTGG - Intergenic
1085644418 11:78213857-78213879 GTAGGGCCTGAGGGAAGCTGTGG + Exonic
1086621381 11:88890117-88890139 GGTGGGGATGTGGGGATGTGGGG - Intronic
1087104848 11:94398928-94398950 GGAGGGGGTGCTGGGCTCTGAGG + Intronic
1087559001 11:99760318-99760340 GGAGCGTCTGAGAGGATCTGGGG + Intronic
1089192342 11:116662064-116662086 GGAGAGGATGAGGGGGTCTGGGG + Intergenic
1089255846 11:117193512-117193534 GAAGGGGCTGAGGGGAGGTAGGG + Intronic
1089298057 11:117481517-117481539 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1089298071 11:117481546-117481568 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1089533249 11:119145451-119145473 GGTGGGGGTGAGGAGATCTGGGG + Intergenic
1089643917 11:119865538-119865560 GGAGAGGCTGAGGCCATCTGGGG - Intergenic
1089683446 11:120132327-120132349 GGCGGGACTGTGGGGATCAGAGG - Intronic
1089751235 11:120652698-120652720 GGAAGGGTAGAGGGGATCAGAGG - Intronic
1090044025 11:123315351-123315373 GGAGGGGCTGAGGGGCTGAAAGG - Intergenic
1091101811 11:132881431-132881453 GGAGGAGCTGAGGAGCTGTGAGG + Intronic
1202810024 11_KI270721v1_random:23586-23608 GGAGGGGCTGTGTGGGGCTGTGG + Intergenic
1091587921 12:1826774-1826796 GGAGGGGCCGAGGGGACCAGAGG + Intronic
1091599325 12:1908489-1908511 GGAGAGGCCGAGGGCAGCTGCGG - Intronic
1091719729 12:2803850-2803872 GAAGAGGCTGAGGGGATTTTGGG - Exonic
1091875348 12:3929098-3929120 GGAGGGGCTGAGGAGAAAAGAGG + Intergenic
1091930033 12:4388760-4388782 GGAGGGGGTGAGGGGGTGAGGGG - Intergenic
1092055596 12:5505848-5505870 GCAGTGGCTGATGGGGTCTGTGG - Intronic
1093390392 12:18612100-18612122 GGAGTGACTGAGGGAGTCTGTGG - Intronic
1094311408 12:29087410-29087432 GGAGGGGCTGGGGCCAACTGTGG - Intergenic
1094847253 12:34366716-34366738 TGTGGGGCTGCGGGGCTCTGTGG + Intergenic
1096112656 12:49038543-49038565 GGTGGGGCTGAGGGTTTCTGTGG + Exonic
1096121870 12:49093853-49093875 GGAAGGGCTGGGGTGAGCTGGGG - Intronic
1096652528 12:53068896-53068918 GGAGGTGCTGAGGGGAGCCCAGG + Intronic
1096789065 12:54034035-54034057 GGAGGGGCTGAGGGGGGGTTGGG - Intronic
1096981850 12:55732658-55732680 GGAAAGGGTGAGGGGATATGAGG + Intergenic
1097009150 12:55940236-55940258 GGAGGGGCTGAGGGCAGCAATGG - Intronic
1099888040 12:88556028-88556050 GGAGGGGCTGATAGTTTCTGGGG + Intronic
1101249434 12:102917371-102917393 GGAGGGGCTGAGGGAGGGTGTGG + Exonic
1101568491 12:105932055-105932077 GGAGGCGCTGGGGTGAGCTGGGG + Intergenic
1101797972 12:107993835-107993857 GGAAGGGTGGAGGGGACCTGGGG - Intergenic
1101802948 12:108038248-108038270 GGAGGGGCTGGGGATATCTGAGG + Intergenic
1102042249 12:109808439-109808461 GCAGGGGCTTTGGGGCTCTGCGG + Exonic
1102443291 12:112979759-112979781 GGAGGTGCTGACTGGATCGGGGG - Intronic
1102908776 12:116696876-116696898 GGAGGAGCCGAGAGGAGCTGGGG + Intergenic
1103599632 12:122046253-122046275 GCAGTGGCTGAGCGGGTCTGGGG + Intronic
1103726502 12:122999872-122999894 GGAGGGGCAGAAGGGGCCTGGGG - Intronic
1103765290 12:123275219-123275241 TGAGGGGCTGAGGGGCTGAGGGG + Intergenic
1103765293 12:123275227-123275249 TGAGGGGCTGAGGGGCTGAGGGG + Intergenic
1104552209 12:129767499-129767521 TCAGGGGCTGAGGGGACATGGGG - Intronic
1104666844 12:130653618-130653640 GGACAGGCTGAGGGGAACTGTGG - Intronic
1106308864 13:28535381-28535403 GGAGAAGCTGAGGGGGACTGAGG + Intergenic
1106783753 13:33086978-33087000 AGCGGGGCTGAGGGGATTGGGGG - Intergenic
1108286570 13:48915040-48915062 GGATAGGCTGAGGAGACCTGAGG - Intergenic
1111948004 13:94685916-94685938 GGAGTGACTGAGGGCATTTGGGG - Intergenic
1111976418 13:94970737-94970759 GGAGAAGCTGAGGAGCTCTGTGG + Intergenic
1112401918 13:99085794-99085816 GGAGGGGCGCAGGGGAATTGAGG - Intronic
1113596383 13:111537100-111537122 GGAGGTGCTGAGGGGCTCAGAGG - Intergenic
1113792975 13:113040565-113040587 GGAGGCGCTGAGGGGACGTGAGG - Intronic
1113871417 13:113562130-113562152 TGTGGTGCAGAGGGGATCTGAGG + Intergenic
1113921529 13:113915835-113915857 GGAGGGGCTGAAAGGACCTGGGG + Intergenic
1114301844 14:21385514-21385536 GGAGGGGCAGGGGAGATGTGGGG - Exonic
1114530038 14:23389752-23389774 GGAGGGGCTGAGTCGACCAGAGG + Intronic
1114712922 14:24796376-24796398 GGAGGTGGTGAGGGGAGGTGAGG - Intergenic
1115149740 14:30270709-30270731 TGACAGGCTGAGGGGAGCTGGGG - Intergenic
1117761579 14:59034713-59034735 GAGGGAGCTAAGGGGATCTGAGG - Intergenic
1118395686 14:65334537-65334559 GGAGGAGCTGAGGTGGTCTGAGG - Intergenic
1118865764 14:69702415-69702437 GGAAGGTCTGAGTGGACCTGAGG - Intronic
1119153633 14:72388531-72388553 GGTGGGGCTGGGGGTGTCTGTGG + Intronic
1119165919 14:72492690-72492712 GGAGGGGCTGAGGGTCTGTTGGG - Intronic
1119650548 14:76379967-76379989 GGAGGGGCAGAGGGGACTTTCGG + Intronic
1119852345 14:77875050-77875072 GGGTGTGCTGAGGGGGTCTGAGG + Intronic
1120211467 14:81637919-81637941 GGAGGGGCTGTGCTGATGTGTGG + Intergenic
1121249608 14:92489792-92489814 GGAGGGGATGAGCGGGTCTCAGG - Intronic
1121974821 14:98393459-98393481 GAAGGGGCTGCTGGTATCTGTGG + Intergenic
1122146057 14:99689460-99689482 GGAGGGGCTGAGGTCATTGGTGG + Intronic
1122157984 14:99762055-99762077 GGTGGGGCTGATGGGCTCAGTGG + Intronic
1122202833 14:100132907-100132929 GGAGGGGCGGAGGGTCTCTGCGG + Intronic
1122371961 14:101233936-101233958 GGTGGGGCTCTGGGGCTCTGGGG - Intergenic
1122441821 14:101737250-101737272 AAAGGGGCTGATGTGATCTGGGG - Intergenic
1122636506 14:103132136-103132158 GGAGGGGCTGAGGGGATTGAAGG - Intronic
1122716770 14:103700791-103700813 GCAGGGACTGGGGGGAGCTGGGG + Intronic
1122879375 14:104683200-104683222 GGAGGGGAGGAGGGGCCCTGGGG + Intergenic
1122883239 14:104699440-104699462 GGAGGGGCGTTGGGGACCTGAGG + Intronic
1122929124 14:104925398-104925420 GGAGGTGGTGAGGCGCTCTGGGG + Intronic
1123035959 14:105472061-105472083 GGAGGCCCTGAGGAGATGTGGGG + Intergenic
1123120324 14:105913435-105913457 GGAGGGGCTGAGGTGATGTCTGG + Intergenic
1123450824 15:20358026-20358048 GGAGGAGCTGGGGGGAGCAGAGG + Intergenic
1123512390 15:21011666-21011688 GGAGGGGCTGAGGTGACATCCGG + Intergenic
1123771797 15:23536686-23536708 GCAAGGACTGAGGGGATTTGGGG - Intergenic
1124118195 15:26867135-26867157 GGGGGCGCTGGGGGGCTCTGCGG + Intronic
1124152714 15:27196299-27196321 GGGAGGGCTGAGGGGAGCAGGGG - Intronic
1125085153 15:35721397-35721419 GGAGGGGCTGTGGGTCTCTCAGG + Intergenic
1125610005 15:40963534-40963556 GGAGGAGCTCAGAGGACCTGTGG + Intergenic
1125724731 15:41862463-41862485 ACAGGGGCTGAGGGGAGGTGTGG + Intronic
1125733722 15:41909238-41909260 GCAGGGGCTGTGGGGCTCTGCGG - Intronic
1125754118 15:42050727-42050749 GGACGGGCTGTGTGGAGCTGAGG + Exonic
1126292663 15:47099657-47099679 GGGGAAGCTGAGGGGATCTGAGG - Intergenic
1127567293 15:60203983-60204005 GGAGGGGTGAAGGGGATCTTTGG + Intergenic
1127626220 15:60782623-60782645 GGAGGGGCAGATGGCAGCTGTGG - Intronic
1127629553 15:60814357-60814379 GGAGAGGCGAAGGGGATCTATGG + Intronic
1128016862 15:64355797-64355819 GGAGGGGCTGAGGGACACAGCGG - Intronic
1128234554 15:66058928-66058950 GAAGGGGCTGAGGTGGTCTGGGG - Intronic
1128801066 15:70497429-70497451 GGTGGGGCTGAGGGGATTCCTGG - Intergenic
1128834110 15:70795227-70795249 GGAGGGGCTGAGGGAGGGTGGGG + Intergenic
1129065146 15:72896576-72896598 TGAGTGGATGAGGGTATCTGGGG + Intergenic
1129075664 15:72993831-72993853 GAAGGGGCTCAGGGGCTCAGAGG - Intergenic
1129250050 15:74303729-74303751 GGAGGAGCTGAGGAGGGCTGGGG - Intronic
1129323511 15:74787657-74787679 GGAGGGGTGGAGGGAAGCTGCGG - Intronic
1129724308 15:77893819-77893841 GGCAGGGGTGAGGGAATCTGAGG - Intergenic
1130255338 15:82323368-82323390 GGAGGGCCGGAGGGAAACTGAGG - Intergenic
1130298642 15:82664261-82664283 CGAGGGGCTCAGGGGCTCTTAGG + Intronic
1130486033 15:84398992-84399014 GTAGGGGCTGAAGGGATCAGGGG + Intergenic
1130599627 15:85266618-85266640 GGAGGGCCGGAGGGAAACTGAGG + Intergenic
1130932126 15:88437029-88437051 AGAGGGAGTGAGGGGAACTGTGG - Intergenic
1131107575 15:89745233-89745255 GGGTGGGGAGAGGGGATCTGAGG + Intergenic
1131236704 15:90703114-90703136 GGAGTGGGTGAGGGGATCTCAGG - Intergenic
1131612860 15:93983367-93983389 GGAGAGGCTGAAGGGATATGGGG - Intergenic
1132314139 15:100878704-100878726 GAAGGGGCTGAGCCTATCTGAGG + Intronic
1132853604 16:2035315-2035337 GGAGGGGTTGGGGGTGTCTGAGG + Intronic
1133322783 16:4924735-4924757 GCAGGGGCTCTGGGGACCTGGGG - Intronic
1133813268 16:9177448-9177470 GGAGGGGAGGAGGGGATGGGAGG - Intergenic
1134076611 16:11296363-11296385 GGTGGGGGTGAGAGGCTCTGAGG + Intronic
1134200656 16:12195895-12195917 GGAGAGGCTGAAGTGAACTGTGG + Intronic
1134388936 16:13800754-13800776 GGAGGGGCTGAGCAGATTTGGGG - Intergenic
1135195372 16:20389773-20389795 GGAGGGGCTGATGGGTGATGGGG + Intronic
1135712421 16:24729458-24729480 GGAGTGGCTGGGGGGGCCTGCGG - Intergenic
1136146914 16:28321353-28321375 GGCGAGGAGGAGGGGATCTGGGG - Exonic
1136236075 16:28914478-28914500 GGAGGAGCTGAGCGGAGATGGGG - Exonic
1136597305 16:31260190-31260212 GGAGAGGCAAAGGGGATTTGGGG + Intronic
1136860823 16:33701210-33701232 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1137567393 16:49542101-49542123 GCAGGGGCTGAGAGGGGCTGTGG - Intronic
1137926424 16:52546415-52546437 GGAGGGGCTGAGGAGAGCGCCGG + Intronic
1139318286 16:66092102-66092124 GAGTGGGCTGAGGGGTTCTGGGG - Intergenic
1139428855 16:66900395-66900417 GGAGTGGCAGAGGGGGTCTGGGG + Intergenic
1139589178 16:67923931-67923953 GGAGGTGCTGAGTTGATGTGAGG + Intronic
1140870518 16:79102059-79102081 GGAGGGGGGGAGGGGGTGTGGGG + Intronic
1141686090 16:85570768-85570790 GGAGGGGCTGAGGGGGAGGGTGG + Intergenic
1141711822 16:85704132-85704154 GGACGGGCTGAGGGGGACAGCGG + Intronic
1141746202 16:85928079-85928101 GGAGGGTCTGAGTTAATCTGAGG + Intergenic
1141928048 16:87182131-87182153 GGAAGGGCTCAGGAGAACTGGGG - Intronic
1141980580 16:87547606-87547628 GGAGGGACTGAAGGGCTCTGGGG + Intergenic
1142232307 16:88905652-88905674 GGCGGGCCTGAGGGGAGGTGGGG + Intronic
1142250503 16:88989699-88989721 GGAGGCCTTGAGGGCATCTGAGG + Intergenic
1142427930 16:90010737-90010759 GGAGGGGCTGAGGGGATCTGTGG - Intronic
1203122318 16_KI270728v1_random:1549393-1549415 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1142623821 17:1180157-1180179 GGAGGGGCCGCGGGGGTCTCGGG + Intronic
1142672651 17:1494215-1494237 GAAGGGGCTGAGGAGAAGTGGGG + Intergenic
1142741093 17:1932423-1932445 GGAGGGGCTGAGGGCGGCCGCGG + Intergenic
1142849192 17:2696131-2696153 GGAGGGGCTGCGGGGCTGGGTGG - Intronic
1143307611 17:5959921-5959943 GGAGGGGCTCAGGGTAGCAGTGG + Intronic
1143445397 17:7006214-7006236 AGAGGAGGTGAGGGGAGCTGTGG + Intronic
1143491560 17:7288177-7288199 GGTGGGGAGGAGGGGATGTGGGG - Exonic
1144496671 17:15750017-15750039 TGAGGGGCTGAGGGGCTGAGGGG + Intergenic
1144496690 17:15750075-15750097 TGAGGGGCTGAGGGGCTGAGGGG + Intergenic
1144782905 17:17816803-17816825 GGAGGGGTGGTGGGGGTCTGCGG + Intronic
1144835342 17:18153943-18153965 GGAGGGGCTGAAGCGAGCAGAGG + Intronic
1144904942 17:18634790-18634812 TGAGGGGCTGAGGGGCTGAGGGG - Intergenic
1145867908 17:28252709-28252731 TGAGGGGCTTAGGAGCTCTGGGG - Intergenic
1146501914 17:33372067-33372089 GGAGAGGCAGAGAGGGTCTGGGG - Intronic
1146537296 17:33663891-33663913 GTAGGGCCTGAGGGACTCTGAGG - Intronic
1146911241 17:36649770-36649792 TGAGGGGCAGAGGGGAGCTCAGG + Intergenic
1147158823 17:38559173-38559195 GGAGGAGCTGAGAGGACTTGGGG + Intronic
1147165445 17:38590857-38590879 GGAAGGACAGAGGGGACCTGTGG - Intronic
1147186541 17:38716312-38716334 GGAGGGAGTGCGGGGATCTGGGG + Intronic
1147318386 17:39631925-39631947 GGAGAGGCTGGGTGGATGTGAGG + Intronic
1147668953 17:42165752-42165774 GGAGGTGCTCAGTGGATTTGAGG + Intronic
1147766160 17:42837714-42837736 GGATGGGGTGAGGGGAGGTGAGG - Intronic
1147952229 17:44113677-44113699 GGAGGGGCAGAGTGAGTCTGGGG - Intronic
1148329763 17:46806820-46806842 GGAGGAGCAGAGGGGAGCGGCGG - Intronic
1149529719 17:57385308-57385330 GGAGGGTCTGAGGGGAGATGAGG - Intronic
1149891180 17:60391876-60391898 GGAGGCGCTGAGGAGAGGTGAGG - Exonic
1150003747 17:61457057-61457079 GGAGCCGCTGCGGGGATCCGAGG + Intronic
1150620113 17:66801821-66801843 GGTGGGGCAGAGGGGATGAGAGG - Intronic
1151373353 17:73664986-73665008 GGAGGTGCTGAGGTTCTCTGTGG + Intergenic
1151509240 17:74548106-74548128 GCAGGAGCTGAGGGGGACTGTGG - Intergenic
1151522672 17:74641531-74641553 GGAGAGGATGAGGGAATCAGAGG - Intergenic
1152160518 17:78665687-78665709 GAAGGGGCTGGGGAGAGCTGCGG + Intergenic
1152334871 17:79695097-79695119 GGAGGGGCTGAGGGAATCTGGGG - Intergenic
1152337616 17:79707309-79707331 GGAGGAGCTGGGGGGAGCAGAGG - Intergenic
1152711128 17:81871025-81871047 GGAGGGGCGGCGGGGACCAGGGG - Intronic
1152795500 17:82304304-82304326 GGAGGGGCTGAGGGGGCCCCTGG + Intergenic
1152817197 17:82415006-82415028 GGAGCGGGGGAGGGGAGCTGGGG + Intronic
1152879811 17:82808480-82808502 GGAGGGGCTGACAGGTGCTGGGG + Intronic
1152925869 17:83087495-83087517 GGAGGGGCAGGAGGGATCCGAGG + Intronic
1153872614 18:9334702-9334724 GGAGGGGAAGAGGGGAGCAGGGG + Intergenic
1154326287 18:13393162-13393184 GCGGGGGCTGAGGGCATCCGTGG - Intronic
1155045306 18:22097967-22097989 GGAAGGGCTGAGGGGAGGTCAGG + Intronic
1155438475 18:25836866-25836888 AGAGGGGCTGAGGGGGTTTCGGG - Intergenic
1155626890 18:27845195-27845217 GGAGTGGGTGAGGGGGTTTGGGG - Intergenic
1157177126 18:45461891-45461913 GGAGAGTCTGAGGTGATGTGGGG + Intronic
1157475377 18:48020674-48020696 GGAGGGGAGGAGGGGAGTTGGGG - Intergenic
1157518781 18:48330468-48330490 AGTGGAGGTGAGGGGATCTGAGG - Intronic
1157589065 18:48825243-48825265 GGAGGGGCAGATGGGATTTCTGG - Intronic
1157763172 18:50280030-50280052 GGAAGGGATGAGGGAAACTGAGG + Intronic
1159962880 18:74568960-74568982 AGAGGGGCTGAGGTGATCAACGG + Intronic
1160201128 18:76796327-76796349 TGAGGGGCTGGGGGGATGTTAGG - Intronic
1160680038 19:408313-408335 GGAGCGGCTTCGGGGGTCTGGGG - Exonic
1160686361 19:438736-438758 GGAGAGGCTGAGGCCATCAGTGG + Exonic
1160762821 19:794175-794197 GGTGGGGCTGAGGGGCTGAGAGG + Intergenic
1160917978 19:1506774-1506796 GCAGGGGCTGCGGGGGGCTGAGG + Exonic
1160975108 19:1789275-1789297 GGTGGGACTGGGGGGACCTGGGG - Intronic
1161033252 19:2069696-2069718 GGAGAGGCTGCAGTGATCTGAGG + Intergenic
1161052826 19:2173878-2173900 GGAGGGGCTCAGGAGGGCTGAGG - Intronic
1161266825 19:3367966-3367988 GCTGGTGCTGAGGGGGTCTGAGG + Intronic
1161288964 19:3482861-3482883 GGAGGGGCGGCGGGGCTCCGGGG + Intergenic
1161307087 19:3574172-3574194 GCCAGGGGTGAGGGGATCTGAGG - Intronic
1161349488 19:3784176-3784198 GGAGGGGCTGCTGGCAGCTGGGG - Exonic
1161401698 19:4068459-4068481 GGAGGGGCCGCGTGGATCTAGGG + Intergenic
1161495870 19:4585203-4585225 GGAGCTGCTGAGAGGATTTGGGG + Intergenic
1161585364 19:5102657-5102679 GGAGAGCCTGAGGGGAGCCGGGG - Intronic
1161587890 19:5115269-5115291 GGGGGTGCTGGGGGGATGTGGGG + Intronic
1161631549 19:5359166-5359188 GGAGGGACTTTGGGGAGCTGAGG + Intergenic
1161714623 19:5868244-5868266 GCAGGGAGTGGGGGGATCTGGGG + Intronic
1161813012 19:6481601-6481623 GCCGGGGCAGAGGGGAGCTGGGG - Intronic
1161843509 19:6696553-6696575 GGAGGGGCTGAGGGGCTGGCAGG - Intronic
1162145759 19:8611307-8611329 GGAGGGGCTGAGTGGGGTTGGGG + Intergenic
1162145777 19:8611346-8611368 GGAGGGGCTGAGTGGGTTGGGGG + Intergenic
1162294239 19:9802189-9802211 GGAGGGGTTGAGGGGACTTCAGG - Intergenic
1162302356 19:9851050-9851072 GGAGGGGGTGAGGGGGTGGGTGG - Intergenic
1162549656 19:11351468-11351490 GGAGGGGATGAGAGGCTCAGGGG + Intronic
1162552467 19:11365284-11365306 GGAGGGGCTGAGAGGAAAAGGGG - Exonic
1162583372 19:11544289-11544311 GGGAGGGCTCAGGGGACCTGAGG + Intronic
1162909609 19:13842136-13842158 GCAGGGGCTGGTGGGAGCTGGGG - Intergenic
1162927096 19:13936161-13936183 GATGGGGAGGAGGGGATCTGAGG - Intronic
1162930978 19:13957482-13957504 CGAGGGGTTGGGGGCATCTGTGG + Intronic
1162955064 19:14092845-14092867 TGAGGGGCTGGGGGGCTGTGGGG + Exonic
1163034857 19:14564534-14564556 GGCGGGGCTGGGGGGATAGGCGG - Intronic
1163035617 19:14567296-14567318 GGAGGGGCTGAGGGTTACTCTGG - Intronic
1163433560 19:17282311-17282333 GGTGGGGTTTAGGGGATCTTGGG + Intronic
1163497544 19:17655532-17655554 GGAAGGGGTGAGGGGCACTGAGG - Intronic
1163672673 19:18637688-18637710 GGGGAGGCTGAGGGGGCCTGGGG + Intronic
1164445556 19:28314724-28314746 GGAGATGCTGTGGGGGTCTGTGG - Intergenic
1164548125 19:29185966-29185988 GGCTGGGCTGAGGGCATCAGAGG - Intergenic
1164737466 19:30552497-30552519 GGAGGAGCTGCTGAGATCTGTGG - Intronic
1165007692 19:32819907-32819929 GGAGAGGCTGAGGTGGGCTGTGG + Intronic
1165072328 19:33262614-33262636 AGAGGGGCTGGGGGGTCCTGGGG - Intergenic
1165079666 19:33300129-33300151 GGAGGGGCTGGGGAAAGCTGAGG + Exonic
1165109863 19:33496026-33496048 GGAGGGGCTGAGGGTGTGTAGGG - Intronic
1165145735 19:33728811-33728833 GGAGGAGCTGGGGTCATCTGGGG + Intronic
1165458053 19:35926296-35926318 GGAGGAGCTGAGGGGCCCAGTGG - Intergenic
1165689633 19:37853593-37853615 GGAGGGGCTGGGGGAGTCCGAGG - Intergenic
1165711356 19:38013020-38013042 TGAGGGGCTTTGGGCATCTGGGG + Intronic
1165941218 19:39415602-39415624 GGAGGGGCATAGGGGATGGGAGG + Intronic
1166008919 19:39926913-39926935 GGAGGGGCTGAGAAGACTTGAGG + Intronic
1166136200 19:40778523-40778545 GGAGGGGTTTAGTGGGTCTGAGG + Intronic
1166138129 19:40789874-40789896 GGGAGGCCTGTGGGGATCTGGGG + Intronic
1166186423 19:41142110-41142132 GGAGGGACAGAGGGAATCTCTGG + Intergenic
1166260980 19:41640583-41640605 GGAGGGGCTGAGGGGGTCCCAGG + Intronic
1166361587 19:42254890-42254912 GGGGGGGCTGAAGGGGTCCGGGG - Intronic
1166561689 19:43736875-43736897 CGAGAGTCTGAGGAGATCTGCGG + Intronic
1166563769 19:43750752-43750774 GGAGGGAATGAGGGGATTTCAGG + Intronic
1166707251 19:44914837-44914859 GCAGGGGTTCAGGGGATCAGTGG - Intronic
1166709352 19:44926921-44926943 GCAGGGGTTCAGGGGATCAGTGG - Intergenic
1167036618 19:46998783-46998805 GGAGGGGCTGATGGAAACAGTGG - Intronic
1167100509 19:47401743-47401765 GGAGGGGCTGAGGGGCACTTGGG + Intergenic
1167216594 19:48169821-48169843 GGAGGGGCTGAAGGGAGCTAAGG - Intronic
1167254510 19:48419228-48419250 GGCGGGGCTGTAGGGCTCTGGGG - Exonic
1167368171 19:49065369-49065391 GGAGGTGGTGGGGGGAACTGTGG - Intergenic
1167509457 19:49888467-49888489 CGAGGGGCTGTGGGGCTCTGCGG - Exonic
1167638843 19:50669116-50669138 GGAGGGGGTGAGGCGCCCTGAGG + Exonic
1167742198 19:51330269-51330291 GGAGGGGGTGGGGGGCCCTGGGG + Exonic
1167792005 19:51689037-51689059 GGAGAGGCGGAGGGGAGCTAGGG + Intergenic
1167981236 19:53277411-53277433 GGAGTGACTGTGGGGCTCTGGGG + Intergenic
1168243517 19:55098727-55098749 TGAGGAGCTGAGGGGACATGGGG + Intronic
1202695093 1_KI270712v1_random:117837-117859 GGAGGGGCTGGCGGGGTCCGGGG + Intergenic
926008933 2:9393476-9393498 CGTGGGGGTCAGGGGATCTGCGG - Exonic
926328447 2:11805279-11805301 GGAGGGGCAGTGGGGGTCAGGGG + Intronic
927074771 2:19566822-19566844 GGAGAGGCTGAGGAGAGCTTGGG - Intergenic
927926088 2:27014726-27014748 GGTGGGGCTGAGGGGTTCTGAGG - Intronic
927942579 2:27114377-27114399 TGAGAGGATGAGTGGATCTGAGG - Intronic
928128823 2:28634436-28634458 GGAAGGGCCAAGGGCATCTGTGG - Intronic
929016494 2:37502540-37502562 GGATGGGCTGGGAGGATATGTGG + Intergenic
929260993 2:39866459-39866481 GGAGGGGCTGAAGGGAGCTTGGG - Intergenic
929462333 2:42112037-42112059 GCAGGTGCAGAGGGGAGCTGGGG - Intergenic
929826013 2:45310274-45310296 GGATGGACTGAGGGGACTTGGGG - Intergenic
929826049 2:45310417-45310439 GGATGGACTGAGGGGACTTGGGG - Intergenic
929826245 2:45311249-45311271 GGACGGACTGAGGGGATTCGGGG - Intergenic
929905730 2:46044835-46044857 GGAGAGGCAGAGCGGAGCTGAGG - Intronic
931338453 2:61374301-61374323 GGAGGTGCTGAGGGGCAGTGTGG - Intronic
932132152 2:69197417-69197439 GGAGGTGATGAAGGAATCTGGGG - Intronic
932321888 2:70828537-70828559 AGAAGGGCTGGGAGGATCTGAGG + Intergenic
932605579 2:73163306-73163328 GGTGGGGGTGAGGGGAGGTGGGG - Intergenic
932790913 2:74654146-74654168 GGCGGGGCTGAGGGGAGGAGAGG - Intergenic
934276263 2:91574886-91574908 GGAGGGGCTGGCGGGGTCCGGGG + Intergenic
934459202 2:94202366-94202388 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
935123015 2:100198613-100198635 GGAGGGGGTGAGGGCAAATGCGG - Intergenic
935953090 2:108348897-108348919 GGAGAAGCTGAAGGCATCTGTGG + Intergenic
936016014 2:108959575-108959597 CATGGGGCTGAGGGGAGCTGGGG + Intronic
936161258 2:110085813-110085835 AGTGGGGCTGAGGGTACCTGAGG - Intronic
936183405 2:110285541-110285563 AGTGGGGCTGAGGGTACCTGAGG + Intergenic
936748429 2:115610212-115610234 TGGGGGGGTGAGGGGAACTGAGG - Intronic
937237011 2:120437137-120437159 GGAGGGGCAGAGTGGAGCTTCGG + Intergenic
937278728 2:120703009-120703031 GGAGGGCCTGAAGTGACCTGGGG + Intergenic
937341659 2:121095302-121095324 GGAGGAGCAGAGGGGAAATGTGG + Intergenic
938310366 2:130285291-130285313 TGATGGTCTGAGGGGCTCTGGGG + Intergenic
938444568 2:131367078-131367100 TGATGGTCTGAGGGGCTCTGGGG - Intergenic
939167419 2:138654290-138654312 GGAGGAGGTGAGTGGAGCTGTGG + Intergenic
941820659 2:169840948-169840970 GGAGGGGCCCAGGGTACCTGTGG - Intronic
942246748 2:174014902-174014924 GCAGGGGCTGTGGAGAACTGGGG + Intergenic
944151040 2:196559199-196559221 GGAGGGTCTAATGGGAACTGTGG - Intronic
944284932 2:197938727-197938749 GGCAGGGCTGATTGGATCTGAGG + Intronic
944427939 2:199603391-199603413 GCAGGGGCAGAAGGGAGCTGGGG + Intergenic
945038144 2:205721907-205721929 GGAGGGGCAAAGGGGAGCTTGGG - Intronic
947528298 2:230893038-230893060 GAAAAGGCTGAGGGGATTTGGGG - Intergenic
947545040 2:231004537-231004559 GGATTGACTGAGGGGATGTGTGG + Intronic
947744739 2:232501815-232501837 GTAGGGGCTGAGTGGATAGGTGG - Intergenic
947752403 2:232539866-232539888 GGAGGGTCTGAGGGGTATTGGGG + Intronic
947941886 2:234064108-234064130 GGAGGGGCAGAGGGGAGGGGAGG - Intronic
948363618 2:237439873-237439895 GGAGGGGCAGAGGGAAGATGAGG - Intergenic
948660817 2:239505531-239505553 GGAGGGGCAGAGGGGCGGTGCGG - Intergenic
948813579 2:240498515-240498537 GGTGGAGCTGAGGGGGTGTGCGG + Intronic
948817420 2:240519617-240519639 GGAAGGGCTGCAGGAATCTGGGG + Intronic
948862147 2:240757855-240757877 GGAGTGGCTGAGGCCATATGAGG + Intronic
948945713 2:241218000-241218022 GGCGGGGCTGGGGGCATCGGGGG + Intronic
948959164 2:241318242-241318264 AGTGAGGCTGAGGGGTTCTGTGG + Exonic
948981266 2:241496100-241496122 GGAGGGGCAGAGGCCAGCTGAGG + Intronic
949028167 2:241775887-241775909 GGCTGGGCTGAGGGGCTCAGAGG - Intergenic
1169251307 20:4063451-4063473 GGAGGGTTTGAGGGCAGCTGTGG + Intergenic
1169276378 20:4236038-4236060 GTAGGGGCTGAGGGCTTCGGTGG + Intronic
1170415407 20:16133746-16133768 AGAGGGGCTGGGGGGAGCTTTGG + Intergenic
1170602070 20:17848852-17848874 GGAGGGGCAGCTGGGAGCTGAGG + Intergenic
1170930615 20:20767005-20767027 GGATAGGCTGTGGGGGTCTGGGG - Intergenic
1170934400 20:20797030-20797052 GGAGGGGCTGGGGAGATGAGTGG + Intergenic
1170979260 20:21195843-21195865 GGTGGGGCTGTGGAGAGCTGGGG - Intronic
1171277838 20:23873791-23873813 GGAGGAGCTGAGGAGATAGGAGG + Intergenic
1171393726 20:24817609-24817631 GGTGGGGCTGAACGGACCTGGGG - Intergenic
1171517774 20:25751158-25751180 GGCGGGGCTGAGGGGAGGGGTGG + Intergenic
1171536711 20:25898936-25898958 GGGGAAGCTGAGGGGGTCTGAGG + Intergenic
1171815637 20:29783721-29783743 GGTGGGGCTAGGGGTATCTGTGG - Intergenic
1172322615 20:34008274-34008296 GGAGATGCTGAAGGAATCTGGGG + Intronic
1172385810 20:34533280-34533302 GTAGGGGCTGGGGAGGTCTGTGG + Intronic
1172579316 20:36034284-36034306 GGAGGTCTTGAGGGGAGCTGAGG + Intergenic
1173166288 20:40689129-40689151 GGTGGGGCTGAGGGGAGGCGTGG + Exonic
1173593944 20:44247168-44247190 GGAGGGGGCGAGGGGATCCCGGG - Intronic
1173626312 20:44475739-44475761 GGAGTGGCTGGGAGGAGCTGGGG - Intergenic
1175666014 20:60860763-60860785 GGAGGGGCTGGTGGGCTTTGGGG - Intergenic
1175789172 20:61730994-61731016 GGAGCAGCTGAGGGGGTCTCAGG + Intronic
1175891216 20:62316851-62316873 GCTGGGGCTGAGGGGAAGTGAGG + Intronic
1175891522 20:62318048-62318070 GGAGGGGGTGAGGAGAGATGGGG + Intronic
1175958653 20:62624056-62624078 GGCGGGGCTGTGGGGAGCAGTGG + Intergenic
1176086237 20:63296828-63296850 GCAGGGGCTGGGGGGCACTGGGG - Intronic
1176106556 20:63392260-63392282 GCAGGGGCTGGGGGGCACTGGGG + Intergenic
1176371174 21:6062063-6062085 GCAGGGGCTGTGAGGAGCTGAGG - Intergenic
1177166772 21:17612644-17612666 GGCGGGGCTGTGGGTATCGGGGG - Intronic
1177509767 21:22070268-22070290 GCATGGGCTGAGAGGATTTGAGG + Intergenic
1178902077 21:36606087-36606109 GGAGGGGCTGGGTGGGTCTGGGG + Intergenic
1179155479 21:38847392-38847414 AGAGGGGCTGGGGGCGTCTGAGG - Intergenic
1179192201 21:39133172-39133194 GGAGGGGCTGAGGTGAGCCGAGG + Intergenic
1179407140 21:41135744-41135766 GGGTGGGCTGAGAGGATGTGAGG - Intergenic
1179595303 21:42439044-42439066 GACGGGGCGAAGGGGATCTGAGG - Intronic
1179752345 21:43476478-43476500 GCAGGGGCTGTGAGGAGCTGAGG + Intergenic
1179996465 21:44976621-44976643 TGAGGGGCTGAGGGGTCCGGGGG + Intronic
1180021712 21:45132610-45132632 GGGTGGGCTTAGGGGATGTGAGG + Intronic
1180041371 21:45282066-45282088 GGAGGGGCTGAGCTGGGCTGGGG - Intronic
1180090973 21:45533711-45533733 GCAGGGGCTGAGGTCACCTGGGG - Intronic
1180184492 21:46132721-46132743 GGAGGGCCTGGGGAGACCTGGGG - Exonic
1180611160 22:17098987-17099009 AGAGGTGCTGAGGGAGTCTGTGG + Intronic
1180955602 22:19739867-19739889 GGAGGGAGTGAGGGGGTGTGGGG + Intergenic
1180956543 22:19743818-19743840 GGATGGGCAGAGGGGGGCTGTGG - Intergenic
1181144290 22:20833262-20833284 GGAGGGGTTGAGGTGTTCTTGGG + Intronic
1181162614 22:20967140-20967162 GGAGGGGCTGGGGGGCGGTGTGG - Intronic
1181169398 22:20999804-20999826 GGTGGGTCTGGTGGGATCTGAGG + Exonic
1181277391 22:21695344-21695366 GGAGGGGCTGAGGGAGGGTGTGG + Intronic
1181312361 22:21952348-21952370 GCAGGGACTGGGGGGATATGGGG + Intronic
1181357007 22:22304123-22304145 CAAGGGGCTGAGAGGAACTGAGG - Intergenic
1181577047 22:23801875-23801897 TGAGGGGGTGAGGGCAGCTGAGG - Intronic
1181703665 22:24634791-24634813 GGAGGGGCTGCGGGGGGCGGTGG - Intergenic
1182446447 22:30392556-30392578 GGAGGGCCGGAGGGGTGCTGGGG - Intronic
1182714140 22:32341385-32341407 GGAGGGGCTGAGGGGAACTGGGG - Intergenic
1183198201 22:36367846-36367868 GGAGGGGAGGAGGGGGCCTGGGG - Intronic
1183303780 22:37071196-37071218 GGAGGGGCTGTGGGGGGCGGGGG - Intronic
1183349208 22:37325222-37325244 GGAGGGGAGGAGGGAAACTGAGG + Intergenic
1183700873 22:39450302-39450324 GGAGGAGCTGTGGGTACCTGGGG + Intergenic
1183765017 22:39865227-39865249 GGAGGGGCTCTGATGATCTGGGG - Intronic
1184046642 22:41976536-41976558 GGAGGGGCGCAGGGGACCAGTGG - Intronic
1184248913 22:43249302-43249324 GGCGGGGTGGAGGGGAGCTGGGG + Intronic
1184401456 22:44276975-44276997 GGAGGGGCTGAGGGGAACTGGGG - Intronic
1184562089 22:45269218-45269240 GGCGGGGCTGAGAGGAGGTGGGG + Intergenic
1184693799 22:46129058-46129080 GGAGTGACTTAGGTGATCTGGGG - Intergenic
1184853910 22:47136268-47136290 AAAGGGGCTGTGGGGACCTGGGG - Intronic
1185266893 22:49908991-49909013 GGAGAGGCTGGGGTAATCTGGGG + Intronic
1185296308 22:50057008-50057030 GGAGGGTGTGGGGGGCTCTGGGG + Intergenic
1185313507 22:50169532-50169554 GGCGGGGCTGTGGGGAGCGGAGG + Intergenic
1185336796 22:50274624-50274646 AGAGGTGCTGAGGGGAGGTGGGG - Intergenic
949809056 3:7986188-7986210 GCAGAGGCTGATGGGGTCTGGGG + Intergenic
950043422 3:9934265-9934287 GCAGGGGCTGTGGGGATGGGTGG - Intronic
950100474 3:10353512-10353534 GGAGGGGCTGAGGGAAGATGTGG + Intronic
950148654 3:10669361-10669383 GTATGGGCTGGGGAGATCTGGGG - Intronic
950206058 3:11082058-11082080 GGAGAGGCTGAGGGAACCTTTGG + Intergenic
950487337 3:13281513-13281535 GGTGGGGCTGGGGGGCTCTTTGG - Intergenic
950770314 3:15305973-15305995 GGAGAGGTAGAGGGGATGTGGGG - Intronic
950865189 3:16183123-16183145 GGAGGGGTTCAGGGGATCCTTGG - Intronic
951619727 3:24587958-24587980 TGGGGAGCTGAGGGGATATGAGG - Intergenic
952230451 3:31424219-31424241 GGTGATGCTGAGGGGATATGGGG + Intergenic
952881644 3:37989589-37989611 GGGTGGGCTGAGGGGAGATGGGG + Intronic
953929662 3:46999601-46999623 GGATGGGTTGGGGGGACCTGAGG - Intronic
954380840 3:50218254-50218276 GGAGGGGCTGTGGGGAAGTGGGG - Exonic
954387081 3:50249729-50249751 GGATGAGGGGAGGGGATCTGGGG - Intronic
954529222 3:51304048-51304070 TGAGGGGCTGCGGAGACCTGCGG - Intronic
954596485 3:51829808-51829830 GGAGGGCTTGAGGGGATAAGAGG - Intronic
954614899 3:51964515-51964537 GGGGGTGCTGAGAGGATGTGGGG - Intronic
954848792 3:53582798-53582820 GGACTTGGTGAGGGGATCTGTGG + Intronic
954915609 3:54146725-54146747 GGAGGCCCTGAGGGAGTCTGCGG + Intronic
955358361 3:58250596-58250618 GTGGTGGCTGAGGGGAGCTGCGG + Intronic
955567710 3:60266617-60266639 GGAGTGGGAGATGGGATCTGAGG - Intronic
956172833 3:66446218-66446240 GGTGGGGTTGGAGGGATCTGAGG - Intronic
961073957 3:123964225-123964247 GGAGGGGATGAGGGGACCTAAGG + Intergenic
961205447 3:125077771-125077793 GGTGGAGCAGAGAGGATCTGAGG - Intergenic
961309663 3:125987904-125987926 GGAGGGGATGAGGGGACCTAAGG - Intergenic
961793376 3:129392499-129392521 GGAGGCCATGGGGGGATCTGAGG - Intergenic
961820589 3:129573763-129573785 AGAGGGGCGAATGGGATCTGAGG + Intronic
962403260 3:135079484-135079506 TGATGGGGTCAGGGGATCTGTGG - Intronic
964222718 3:154365273-154365295 GGAGGGGCCCAGGGCACCTGTGG - Intronic
964368118 3:155970906-155970928 GGTGGGCCTGAGGGGTGCTGTGG + Intergenic
965142148 3:164851593-164851615 GGTGAGGCTGAGAGGATGTGAGG + Intergenic
965514704 3:169608488-169608510 GGAGGGGATGTGGGGAAATGTGG - Intronic
966629600 3:182057852-182057874 TGAGAGGCTGAGGGGTGCTGTGG - Intergenic
966818720 3:183908875-183908897 GAAGGGGAGGAGGGGTTCTGGGG + Intergenic
967561980 3:190926779-190926801 GGAGGGGCTGAGGTGTTCTCAGG + Intergenic
968337376 3:197925254-197925276 GGATGGGATGAGGTCATCTGTGG + Intronic
968337431 3:197925425-197925447 GGATGGGATGAGGTCATCTGTGG + Intronic
968581192 4:1396159-1396181 GGGTTTGCTGAGGGGATCTGAGG - Intergenic
968622033 4:1608201-1608223 GGAGGGGCTGAGGAGACCAGGGG - Intergenic
968629271 4:1641820-1641842 GCGGGGGCTGAGGAGAGCTGAGG - Intronic
968654799 4:1773794-1773816 GACAGGGGTGAGGGGATCTGAGG + Intergenic
968808280 4:2788728-2788750 GGAGGGGCAGAGGGGGTGTGGGG - Intergenic
968820123 4:2843885-2843907 GGAGGGGCTGAGGGGCGGAGAGG + Exonic
968957544 4:3726915-3726937 GGGGGCGCTGAGCGGCTCTGGGG + Intergenic
969086351 4:4659473-4659495 GGGGGAGCTCAGGGGTTCTGAGG + Intergenic
969454805 4:7294936-7294958 GGAGGGGGAGGGGGGAGCTGGGG - Intronic
969471569 4:7392318-7392340 GGAGCGGGTGATGGGCTCTGCGG + Intronic
972418966 4:38868491-38868513 GGAGGGGGCCTGGGGATCTGCGG - Exonic
973663576 4:53134167-53134189 GGCTGGGGTGAGGGGAACTGGGG + Intronic
975006667 4:69297014-69297036 GGAGGGACTGGGTGGAGCTGAGG - Intronic
977803491 4:101267583-101267605 GGAGGGGATAAGCGGATCTGAGG + Intronic
979218288 4:118192797-118192819 GAAGAGGCTGAGGGGGTTTGGGG + Intronic
979629557 4:122884814-122884836 GGAGGTGCTGGGGGGATGTGAGG + Intronic
980467328 4:133202917-133202939 GAAGGGGCTGAGGAGAGGTGAGG + Intronic
981541889 4:145854579-145854601 GGTGGGGCTGAGGCTTTCTGTGG - Intronic
982561299 4:156931045-156931067 GTAGGGGCTGAGGGGATGGAGGG + Intronic
984712509 4:182897713-182897735 GACAGGGCTGAGGGGGTCTGGGG - Intronic
984727580 4:183036261-183036283 GAAAGGGCTGTGGGGATCTGAGG + Intergenic
985525832 5:401215-401237 GGAGGGGCTGCAGGAGTCTGAGG + Intronic
986082623 5:4410031-4410053 GCAGGGGCCGGGGGGAGCTGTGG + Intergenic
986506837 5:8460302-8460324 GGAGGTGCCGACGGGATGTGAGG - Intergenic
986748168 5:10761652-10761674 GCAGGGGCTGAGGGCCTCAGGGG - Intergenic
987481421 5:18463448-18463470 GGAAGGGTAGCGGGGATCTGGGG + Intergenic
988946258 5:36203906-36203928 GGAGAGGGAGAGGGGTTCTGAGG - Intronic
989173748 5:38499828-38499850 GGAGGGAGTGAGAGGATGTGAGG - Intronic
989185104 5:38616117-38616139 TGAGGCGCTGAAGAGATCTGAGG - Intergenic
990988177 5:61660157-61660179 GGAGGGGCAGAGGGGAATGGTGG + Intronic
992487423 5:77210371-77210393 GGAGGGGCGGAGGGGCGCAGTGG + Intergenic
992888377 5:81181756-81181778 GGAAGGGAGGAGGGGAGCTGAGG - Intronic
994402896 5:99304615-99304637 GGAGGGTGTAAGGAGATCTGGGG + Intergenic
996415217 5:123203297-123203319 GGAAAGGCTGAGTTGATCTGAGG - Intergenic
996762921 5:127003975-127003997 GGAGTGGCTGAGGGAGGCTGGGG + Intronic
997019116 5:129976141-129976163 GTAGGGTCTGTGGGGATCTAAGG - Intronic
997408287 5:133669797-133669819 GCATGGGCTGGGTGGATCTGTGG - Intergenic
997526264 5:134555133-134555155 GGAGGGACAGAGGGGGCCTGGGG - Intronic
997537312 5:134632812-134632834 GAAGGGGCTGATGCGAACTGGGG - Exonic
997641034 5:135449101-135449123 AGAGGCCCTGAGGGGTTCTGGGG - Exonic
997869442 5:137494346-137494368 TCAGGGGCTGAGTGGATTTGGGG - Intronic
998013818 5:138716576-138716598 GGTGGGGCTGAGAGGATGTGGGG + Intronic
998154358 5:139776051-139776073 GGAGGGGTTCAGGGGCCCTGGGG + Intergenic
998767020 5:145499633-145499655 GCAGGGCCTGAGGGAAGCTGTGG + Intronic
999093638 5:148958830-148958852 GGAGGTGCTCACGGGAACTGGGG - Intronic
999400828 5:151263052-151263074 GAAGGAGCAGAGGGGATCTGAGG - Intronic
999683485 5:154081689-154081711 GAAGGGGTAAAGGGGATCTGAGG - Intronic
1001193835 5:169653939-169653961 GGAGGGGCTCAGGGTCTCAGAGG + Intronic
1001479598 5:172078856-172078878 GGAAAGGGTGAGGAGATCTGTGG + Intronic
1001855100 5:175003951-175003973 TGGGGGGCTGAGGCAATCTGGGG + Intergenic
1001956936 5:175854125-175854147 GTAGGGGCTCAGGGGTGCTGGGG - Intronic
1002093371 5:176817436-176817458 GGAGAGGCTGTGGGGGTCTACGG + Intronic
1002158209 5:177299511-177299533 AGAGGGGCAGAAGGGAGCTGAGG - Exonic
1002426299 5:179178253-179178275 GGAGGTGCGGGGGGGATCTTTGG - Intronic
1002582365 5:180216470-180216492 GGAGGTGCTGCAGGGAGCTGTGG + Intergenic
1002807578 6:591843-591865 GGAGGCCCTGAGGGAAGCTGGGG - Intronic
1003107727 6:3228429-3228451 GGCAGGGCTGAGGGGCTCCGAGG - Intronic
1003412841 6:5880746-5880768 GGAGGCAATGAGGGGATGTGAGG + Intergenic
1003425929 6:5998354-5998376 GAAGGGGCTGAGGAAATCTCTGG - Exonic
1003692940 6:8372721-8372743 GTGTGGGCTGAGGAGATCTGAGG - Intergenic
1003818461 6:9867926-9867948 GGAGGGAATGCGGGGATGTGGGG - Intronic
1004221955 6:13754776-13754798 GGAAGGGCTGAGTGGCTCAGAGG + Intergenic
1004516372 6:16325567-16325589 GGAGGGAGTGAGGGGAAATGTGG - Intronic
1005431741 6:25764698-25764720 TGAGGGGCTCATGGGGTCTGTGG - Intronic
1005520589 6:26597401-26597423 GGGCGGGCGGAGGGGATATGGGG + Intronic
1006022164 6:31123694-31123716 GGAGGGGTGGAGGGGACCAGAGG - Intronic
1006102087 6:31691766-31691788 GGAGGGCTTTAGGGGATGTGCGG + Intronic
1006154442 6:32006725-32006747 GGTGGGCCTGAGGGGCTGTGAGG - Intergenic
1006160755 6:32039461-32039483 GGTGGGCCTGAGGGGCTGTGAGG - Intronic
1006165961 6:32065023-32065045 GGAGAGGCTGAGGGAGTCGGAGG + Intronic
1006377349 6:33678845-33678867 GGCGGGGCTGAGGGGTGCTCAGG + Intronic
1006589739 6:35145734-35145756 AGAAGGGTTGAGGGAATCTGGGG + Intronic
1006893164 6:37447334-37447356 TGAGGGGCTCATGGGTTCTGGGG + Intronic
1007361082 6:41356306-41356328 TCAGGGACTGGGGGGATCTGGGG + Intergenic
1007410847 6:41660410-41660432 GGAGGTGGGGAGGGGCTCTGTGG - Intergenic
1009469292 6:64012031-64012053 GGAGGGGGTGAGGGGACAAGAGG - Intronic
1011297713 6:85841300-85841322 GGAGAGGCTGAGCTGATCAGGGG + Intergenic
1013929566 6:115514800-115514822 GAAGAGGCTGAGGCAATCTGGGG - Intergenic
1015530511 6:134217075-134217097 ACAGGAGCTGAGGGGATCAGGGG + Intronic
1015976442 6:138796008-138796030 GGAGGGGCTGCGGGCCTGTGGGG + Intronic
1017407581 6:154136576-154136598 GGAGGGGCTGAGGGATTAGGTGG - Intronic
1018266604 6:162030901-162030923 GGAGGGGCTGGAGTGAGCTGAGG - Intronic
1018846893 6:167562618-167562640 TGAGGGAATGAGGGAATCTGTGG - Intergenic
1019112054 6:169724391-169724413 GGCGGGGCTGAGGCGAGCGGCGG - Intronic
1019112059 6:169724409-169724431 GGCGGGGCTGAGGCGAGCGGCGG - Intronic
1019112064 6:169724427-169724449 CGCGGGGCTGAGGGGAGCGGCGG - Intronic
1019123887 6:169826165-169826187 GAAGGGGCTGAGGGGGTACGAGG + Intergenic
1019224230 6:170496881-170496903 GGAGGGGCTGAGGGAATAGTAGG + Intergenic
1019494659 7:1332147-1332169 GGAGGGGCTGGGAGGAGCGGGGG + Intergenic
1019614525 7:1953104-1953126 GGAGGGGGTGAGGAGGTCTGAGG + Intronic
1019656313 7:2197961-2197983 GGAGGGGCTGATGGGCCCTGTGG - Intronic
1019777149 7:2918571-2918593 GGAGGAGCTGCTGGGCTCTGGGG + Exonic
1021506679 7:21393220-21393242 GGAGTGGCTGTGGGGATTTTTGG - Intergenic
1022610470 7:31866966-31866988 GTAGGGGGTTAGGGGATGTGTGG - Intronic
1023028707 7:36074620-36074642 GAAGGGGTCGAGGGGATCTTGGG + Intergenic
1023758165 7:43439663-43439685 GGGAGGGCAGAGGGGCTCTGCGG - Intronic
1023843982 7:44111032-44111054 GGAGGTGCTGGGGTGCTCTGTGG + Exonic
1023845709 7:44119076-44119098 GAATGGGTGGAGGGGATCTGAGG - Intronic
1023868843 7:44252035-44252057 GGAGGGGCTGTGGGTGTGTGTGG + Intronic
1023965294 7:44960916-44960938 TGAGGGGCTGAGGGGCTGAGGGG + Intergenic
1023965451 7:44961379-44961401 GAGGGGGCTGAGGGGATGAGGGG + Intergenic
1023965611 7:44961874-44961896 GAAGGGGCTGAGGGGCTGAGAGG + Intergenic
1024669921 7:51585061-51585083 GCAGGGTCTGAGGGGTTGTGGGG + Intergenic
1024772165 7:52736158-52736180 GAATGGGCTGAGGGGGTCAGAGG + Intergenic
1024926308 7:54619038-54619060 GGAAGTGCTGAGGGGAAATGTGG - Intergenic
1025790100 7:64680920-64680942 GGAGGGGCTGCTGGGCGCTGCGG - Intronic
1026447107 7:70494556-70494578 GGAGGGGCGGTGGGGACGTGGGG - Intronic
1026913578 7:74106789-74106811 TGAGGGGTTGAGGGGAGCTGGGG + Intronic
1026954056 7:74365733-74365755 GGTGGGGATGAGGGGATGAGTGG - Intronic
1026972589 7:74477383-74477405 GGAGGGCCAGAGGGCATTTGGGG + Intronic
1027051923 7:75026021-75026043 GGAGGGGGTGAGGGAACCCGAGG + Intergenic
1028478902 7:91282989-91283011 TGAGGGGCTGAGGGGAAATGGGG - Intergenic
1029538632 7:101170341-101170363 GGAGGTGGAGAGGGGTTCTGAGG - Intergenic
1030114534 7:106053356-106053378 GGCCTGGCTGAGGGCATCTGGGG + Intergenic
1030748086 7:113193368-113193390 TGAGGGGCTGAGGGTATGTGGGG - Intergenic
1032505472 7:132431312-132431334 GGAGGGGGAGAGGGGAGGTGGGG - Intronic
1033478696 7:141716483-141716505 GGAGGGGAGGAGGGGAGATGGGG - Intronic
1033756003 7:144398796-144398818 GAAAGGGATAAGGGGATCTGGGG - Intronic
1034263844 7:149772364-149772386 GGAGGGGAAGAGCGGTTCTGGGG - Intronic
1034471176 7:151255161-151255183 GCAGGAGTTGAGGGGGTCTGGGG - Intronic
1035049071 7:155988076-155988098 GGGTGGGCTGGGTGGATCTGAGG + Intergenic
1035451672 7:158980840-158980862 GGAAGGTCTGCGGGGATGTGGGG + Intergenic
1035464006 7:159063731-159063753 GGAGGGCCTGGCGGGATCTGGGG + Intronic
1035464080 7:159063883-159063905 GGGGGTCCTGGGGGGATCTGGGG + Intronic
1035945064 8:3953732-3953754 GGAGCAGCTCAGGGGCTCTGTGG - Intronic
1036701981 8:11019010-11019032 GGAGTGGGTGAGGGGGCCTGAGG - Intronic
1037240656 8:16773451-16773473 GAAGGGGCTGAGGGTATGTGTGG - Intergenic
1037704651 8:21309104-21309126 GCAGGGGATGAGGGGAGCAGAGG - Intergenic
1037764484 8:21763827-21763849 AGAGGGGCTGAGGAGCTCAGGGG - Intronic
1037778221 8:21849491-21849513 AGAGGGGCTGTGGGGCTGTGTGG + Intergenic
1037980142 8:23247181-23247203 GGAGAGGAAGAGGGGATCTGGGG + Intronic
1038142914 8:24865786-24865808 GATGGGGCTGAGAGGATGTGGGG - Intergenic
1038149290 8:24928100-24928122 GGGGAAGCTGAGGGGAGCTGAGG + Intergenic
1038319079 8:26512338-26512360 GGAGGGGCTGAGAGAACCGGAGG - Intronic
1038641683 8:29333995-29334017 GGAGGGAATGATGGGAGCTGGGG + Exonic
1039258082 8:35740846-35740868 GGAGGGGCTCAGGAGTTTTGAGG - Intronic
1039452707 8:37688484-37688506 GGAGGGGCTGAGGTTTCCTGTGG + Intergenic
1041095242 8:54343131-54343153 GGAAGGGCTGAGGGGAGAGGAGG - Intergenic
1041163807 8:55071878-55071900 GGATGGGCTGAGGGGGTTGGGGG + Intergenic
1041328008 8:56689661-56689683 GGAAGGCCTGAGGAAATCTGAGG - Intergenic
1043138480 8:76558110-76558132 GGAGGGGCCCAGGGCATCTGTGG + Intergenic
1043855725 8:85262713-85262735 GGAGTGGCTAAGGGGAGCTTTGG + Intronic
1045530207 8:102977498-102977520 GTGGGGGCTGAGGGGATAGGAGG + Intronic
1046592724 8:116225433-116225455 GGAAGGGCAGAGGGGCTCTTGGG - Intergenic
1049065907 8:140313750-140313772 GCAGGGGCAGAAGCGATCTGCGG + Intronic
1049541042 8:143209118-143209140 GGTGGGGCTGAGGGTGTCTAAGG + Intergenic
1049623706 8:143610858-143610880 GAAGGGGCTGGGAGGATCCGAGG - Intergenic
1049638914 8:143705535-143705557 GGAGGTGCTGGGGGGGACTGGGG + Intronic
1049642030 8:143720162-143720184 GGGGCGGCTCAGGGCATCTGGGG - Intronic
1049699309 8:144001323-144001345 TGAGAGGCTGAGGGTCTCTGAGG - Intronic
1049737755 8:144218801-144218823 GGAGGGGAGGAGGGGAGGTGAGG - Intronic
1049861291 8:144901153-144901175 GGAGGGCCTGAGGGGGTCCAAGG + Intronic
1050099702 9:2105770-2105792 TGAGGGGCTGTGGGGTTGTGGGG + Intronic
1052603520 9:30670926-30670948 GCAGGGGTTGAGGGGACCAGGGG - Intergenic
1053123235 9:35561114-35561136 GGAAGGGCTGAGGGGGGCGGGGG + Intronic
1053157733 9:35792130-35792152 GGAGGGACCGAGGGGGCCTGCGG - Intergenic
1053689698 9:40578153-40578175 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1053818116 9:41935916-41935938 GGAGGGGATGGGAGGAACTGAGG - Intronic
1054300945 9:63379092-63379114 CAAGGGGCTGAGAGGAACTGAGG + Intergenic
1056189528 9:84171231-84171253 AGTGGGGCTGAGTGGATTTGAGG - Intergenic
1056388219 9:86116846-86116868 GGAGGAGCTGGGGGGAGCAGAGG + Intergenic
1056615281 9:88160237-88160259 GCAGGGGCTGGAGGGAGCTGGGG - Intergenic
1057081440 9:92177137-92177159 GAAGGGGTCGAGGGGCTCTGCGG + Intergenic
1057145668 9:92757589-92757611 GGGGGGGCGGGGGGGAGCTGAGG + Intronic
1057223405 9:93270208-93270230 TGAGGGGCTGAGATGCTCTGAGG - Intronic
1057262106 9:93590801-93590823 AGAGGGGCTGAGGAGACGTGAGG - Intronic
1057478817 9:95427703-95427725 TGCGGGGCTGAGGGGAGGTGTGG + Intergenic
1058261048 9:102832349-102832371 AGAGGGGCAGAGGGAGTCTGTGG - Intergenic
1059383098 9:113943754-113943776 AGAGGGGATGAGGGGGACTGAGG + Intronic
1059414989 9:114156738-114156760 GGAGCGGCTGCGCGGAGCTGGGG + Intronic
1059419664 9:114183159-114183181 GGAGGGCTTCAGGGGAACTGAGG + Intronic
1059623204 9:116032103-116032125 GGAGGGTCTGAGGAGGGCTGGGG - Intergenic
1059691233 9:116687572-116687594 CGTGGGGCTGAGGAGATCCGAGG + Intronic
1060488212 9:124062909-124062931 GGAGGAGCTGCAGAGATCTGGGG - Intergenic
1060840843 9:126792035-126792057 GGGGAGGCAGAGAGGATCTGTGG + Intergenic
1060892090 9:127195393-127195415 GGAGGAGCTGAGGGGCACTGTGG + Intronic
1061079445 9:128361256-128361278 AGTGGGGCTGTGGGGTTCTGGGG - Exonic
1061387027 9:130296415-130296437 GCCGGGGCTGAGGCGAGCTGAGG + Intronic
1061782490 9:133004218-133004240 GGCCGGGCTGAGGGGCGCTGGGG - Intergenic
1061874213 9:133535849-133535871 GGAGGGGGTGGGGAGAGCTGAGG + Intronic
1061970500 9:134042191-134042213 GGAGTTGCTGAAGGGAGCTGTGG - Intronic
1062001197 9:134216582-134216604 CGAGGGGCTGAGCGGCTCTGAGG - Intergenic
1062066163 9:134527439-134527461 GGAGGGGCTGAGCTGCTCAGGGG + Intergenic
1062194098 9:135263799-135263821 GGAGGGGGTGAGGGGAGGGGTGG - Intergenic
1062278559 9:135741962-135741984 AGAGAGGCTGATGGGAGCTGAGG - Intronic
1062433120 9:136534877-136534899 GGAGGGACTGGGGGGCTCTGTGG - Intronic
1062433146 9:136534945-136534967 GGAGGGACTGGGGGGCTCTGTGG - Intronic
1062436243 9:136547744-136547766 GGAGGGGAGGAGGGGATCCCTGG + Intergenic
1062464199 9:136674006-136674028 GGAGGGGCTGTGGGGGGCTGGGG - Intronic
1062501827 9:136855037-136855059 GGAGGCGCCGAGGGGAGCTGGGG + Exonic
1062570633 9:137183512-137183534 TGAGGTCCTTAGGGGATCTGAGG - Intronic
1062690164 9:137837530-137837552 AAGGGGGCTGAGGGGACCTGCGG + Intronic
1203760949 EBV:12857-12879 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203761878 EBV:15929-15951 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203762807 EBV:19001-19023 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203763736 EBV:22073-22095 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203764665 EBV:25145-25167 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203765594 EBV:28217-28239 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203766523 EBV:31289-31311 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1203767452 EBV:34361-34383 GGCGGGCCCGAGGGGCTCTGGGG - Intergenic
1185566549 X:1099539-1099561 GGCGGGGCTGAGGGCACCTGGGG - Intergenic
1185640684 X:1588221-1588243 GGAGGGGAGGAGGGGATGGGAGG - Intergenic
1185640847 X:1588557-1588579 GGAGGGGAGGAGGGGATGGGAGG - Intergenic
1185641029 X:1588940-1588962 GGAGGGGAGGAGGGGATAGGAGG - Intergenic
1185641080 X:1589051-1589073 GGAGGGGAGGAGGGGATGGGAGG - Intergenic
1186198353 X:7131883-7131905 GGAAGGGCTGAGGGTATTTCAGG - Intronic
1186498558 X:10032188-10032210 GGAGGGGAGGAGGGAACCTGAGG + Intronic
1187036404 X:15544782-15544804 TGGGGAGCTGAGGGGTTCTGGGG + Intronic
1187774965 X:22746145-22746167 AGGTGGGCTGAGGGGATATGAGG - Intergenic
1188106544 X:26154214-26154236 GAAGGGGATGTGGGGATGTGGGG + Intergenic
1188971851 X:36627444-36627466 GGAAGGGCAGTGGGGAGCTGGGG - Intergenic
1188972070 X:36630050-36630072 GGAAGGGCAGTGGGGAGCTGGGG - Intergenic
1189103515 X:38214439-38214461 GGAGGCTCTCAGTGGATCTGTGG - Intronic
1189485898 X:41431472-41431494 AGCGGAGCTGAGGGGACCTGGGG - Intergenic
1190309491 X:49106730-49106752 GGAGGAGCTGAGCAGGTCTGGGG - Intergenic
1190333150 X:49248009-49248031 GGAGGGTCTGTGGGCATCTGTGG + Intronic
1190727337 X:53198208-53198230 AGAGAGGCTGAGGGGTTTTGTGG - Intronic
1192240384 X:69323660-69323682 GGAGGGGGTGGGGGGATAAGTGG - Intergenic
1192359130 X:70427229-70427251 GCTGGGGCTTAGGGGATCTGGGG + Intronic
1192550925 X:72052824-72052846 AGAGGGGCTGGGGGGAGCAGAGG - Intergenic
1193013367 X:76703928-76703950 GGAGGGGCTGAGGAAAAGTGGGG + Intergenic
1193042419 X:77017587-77017609 TGAGAGGCTGAGGGGATTGGAGG - Intergenic
1194546841 X:95246150-95246172 TGAGGAGCTGAGGGGAGGTGGGG + Intergenic
1194730118 X:97442994-97443016 GGTGGGGTTGAGGGGCTGTGGGG - Intronic
1195126466 X:101813700-101813722 GGGGAGGCTGAGGGCAGCTGAGG + Intergenic
1195179113 X:102339646-102339668 GGGGAGGCTGAGGGCAGCTGAGG - Intergenic
1196366741 X:114932411-114932433 GGAAGTGCAGAGGGGATATGTGG - Intergenic
1198051673 X:132957601-132957623 GGAGGGGCTCCGGGGAGCTCCGG - Intronic
1198533345 X:137565851-137565873 TGAGTGGCTGCGGGGAACTGGGG - Intergenic
1200210724 X:154345607-154345629 GCTGGGGCTGAGGGGTCCTGTGG + Intergenic
1200220128 X:154386485-154386507 GCTGGGGCTGAGGGGTCCTGTGG - Intergenic
1200430341 Y:3072676-3072698 GGAGGCGCAGCGGGGAGCTGGGG + Intergenic
1202368574 Y:24182856-24182878 GTAGGGGCCGAAGGGATCAGGGG + Intergenic
1202502211 Y:25487261-25487283 GTAGGGGCCGAAGGGATCAGGGG - Intergenic