ID: 1142428590

View in Genome Browser
Species Human (GRCh38)
Location 16:90013789-90013811
Sequence TGGCCGTCCCTCAGAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 130}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142428590_1142428601 19 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428590_1142428602 26 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428602 16:90013838-90013860 CTCCCATTTTAGGGGGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 100
1142428590_1142428598 16 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428598 16:90013828-90013850 CGGGGCTGTGCTCCCATTTTAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1142428590_1142428593 -4 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428593 16:90013808-90013830 GCCAGTGCCAGTGAGCAGTGCGG 0: 1
1: 0
2: 1
3: 34
4: 306
1142428590_1142428599 17 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428599 16:90013829-90013851 GGGGCTGTGCTCCCATTTTAGGG 0: 1
1: 0
2: 1
3: 17
4: 154
1142428590_1142428595 -3 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428595 16:90013809-90013831 CCAGTGCCAGTGAGCAGTGCGGG 0: 1
1: 0
2: 3
3: 17
4: 376
1142428590_1142428600 18 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428600 16:90013830-90013852 GGGCTGTGCTCCCATTTTAGGGG 0: 1
1: 0
2: 1
3: 20
4: 143
1142428590_1142428603 27 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428603 16:90013839-90013861 TCCCATTTTAGGGGGCATCTGGG No data
1142428590_1142428605 28 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428605 16:90013840-90013862 CCCATTTTAGGGGGCATCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 134
1142428590_1142428596 -2 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428596 16:90013810-90013832 CAGTGCCAGTGAGCAGTGCGGGG 0: 1
1: 0
2: 1
3: 17
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142428590 Original CRISPR TGGCCGTCCCTCAGAAGGGC AGG (reversed) Intronic