ID: 1142428597

View in Genome Browser
Species Human (GRCh38)
Location 16:90013815-90013837
Sequence CACAGCCCCGCACTGCTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 277}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142428597_1142428602 0 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428602 16:90013838-90013860 CTCCCATTTTAGGGGGCATCTGG 0: 1
1: 0
2: 0
3: 8
4: 100
1142428597_1142428600 -8 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428600 16:90013830-90013852 GGGCTGTGCTCCCATTTTAGGGG 0: 1
1: 0
2: 1
3: 20
4: 143
1142428597_1142428609 23 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428609 16:90013861-90013883 GGAGGGTGCTCTACCAAACTTGG 0: 1
1: 0
2: 1
3: 3
4: 68
1142428597_1142428610 26 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428610 16:90013864-90013886 GGGTGCTCTACCAAACTTGGAGG No data
1142428597_1142428603 1 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428603 16:90013839-90013861 TCCCATTTTAGGGGGCATCTGGG No data
1142428597_1142428599 -9 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428599 16:90013829-90013851 GGGGCTGTGCTCCCATTTTAGGG 0: 1
1: 0
2: 1
3: 17
4: 154
1142428597_1142428607 5 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428607 16:90013843-90013865 ATTTTAGGGGGCATCTGGGGAGG 0: 1
1: 0
2: 0
3: 8
4: 156
1142428597_1142428605 2 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428605 16:90013840-90013862 CCCATTTTAGGGGGCATCTGGGG 0: 1
1: 0
2: 1
3: 11
4: 134
1142428597_1142428598 -10 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428598 16:90013828-90013850 CGGGGCTGTGCTCCCATTTTAGG 0: 1
1: 0
2: 2
3: 9
4: 111
1142428597_1142428601 -7 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428597_1142428611 29 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428611 16:90013867-90013889 TGCTCTACCAAACTTGGAGGAGG 0: 1
1: 0
2: 0
3: 6
4: 90
1142428597_1142428608 6 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428608 16:90013844-90013866 TTTTAGGGGGCATCTGGGGAGGG 0: 1
1: 0
2: 0
3: 14
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142428597 Original CRISPR CACAGCCCCGCACTGCTCAC TGG (reversed) Intronic