ID: 1142428601

View in Genome Browser
Species Human (GRCh38)
Location 16:90013831-90013853
Sequence GGCTGTGCTCCCATTTTAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142428594_1142428601 -1 Left 1142428594 16:90013809-90013831 CCAGTGCCAGTGAGCAGTGCGGG No data
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428592_1142428601 14 Left 1142428592 16:90013794-90013816 CCTTCTGAGGGACGGCCAGTGCC 0: 1
1: 0
2: 0
3: 7
4: 128
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428591_1142428601 15 Left 1142428591 16:90013793-90013815 CCCTTCTGAGGGACGGCCAGTGC 0: 1
1: 0
2: 0
3: 10
4: 74
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428590_1142428601 19 Left 1142428590 16:90013789-90013811 CCTGCCCTTCTGAGGGACGGCCA 0: 1
1: 0
2: 1
3: 18
4: 130
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data
1142428597_1142428601 -7 Left 1142428597 16:90013815-90013837 CCAGTGAGCAGTGCGGGGCTGTG 0: 1
1: 0
2: 2
3: 15
4: 277
Right 1142428601 16:90013831-90013853 GGCTGTGCTCCCATTTTAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142428601 Original CRISPR GGCTGTGCTCCCATTTTAGG GGG Intronic