ID: 1142428625

View in Genome Browser
Species Human (GRCh38)
Location 16:90013910-90013932
Sequence CCGCCCCACCCAGTATCACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 110}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142428625_1142428638 28 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428638 16:90013961-90013983 AGTGCATTTGAGGACAGCTGGGG 0: 1
1: 0
2: 0
3: 19
4: 225
1142428625_1142428637 27 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428637 16:90013960-90013982 GAGTGCATTTGAGGACAGCTGGG 0: 1
1: 0
2: 0
3: 6
4: 163
1142428625_1142428634 18 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428634 16:90013951-90013973 GCCTGAGCAGAGTGCATTTGAGG 0: 1
1: 0
2: 1
3: 14
4: 159
1142428625_1142428636 26 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428636 16:90013959-90013981 AGAGTGCATTTGAGGACAGCTGG 0: 1
1: 0
2: 2
3: 15
4: 160
1142428625_1142428633 -4 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428633 16:90013929-90013951 GCGGGGGGGGACATGCATAAAGG 0: 1
1: 0
2: 0
3: 1
4: 51
1142428625_1142428639 29 Left 1142428625 16:90013910-90013932 CCGTGTGATACTGGGTGGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 110
Right 1142428639 16:90013962-90013984 GTGCATTTGAGGACAGCTGGGGG 0: 1
1: 0
2: 1
3: 15
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142428625 Original CRISPR CCGCCCCACCCAGTATCACA CGG (reversed) Intronic
900326437 1:2110711-2110733 CCACCCCACCCACACTCACAGGG - Intronic
901160194 1:7171458-7171480 CTGCCTCCCCCAGTATCTCAGGG + Intronic
901773791 1:11545242-11545264 CCGCCCCACCAGGTTTCAGAGGG + Intergenic
904457125 1:30654502-30654524 CCTCCCCACCCACCACCACATGG + Intergenic
904617816 1:31759462-31759484 CCGCCCCATCAAGAAGCACAAGG + Intronic
904987126 1:34561211-34561233 CAGCACCACCCAGTATCCCATGG + Intergenic
905695431 1:39970036-39970058 CGCCCCCACCCAGTAGCACCTGG - Intergenic
905738747 1:40351018-40351040 CCTCCTTACCCAGAATCACAAGG + Intronic
905974511 1:42164982-42165004 CGGCCCCACACAGCAGCACAGGG - Intergenic
912214584 1:107593522-107593544 CTGTCCAACCCAGTATCCCAAGG + Intronic
917122028 1:171652757-171652779 CAGCCCCACCCAGCCTCACGTGG - Intergenic
1065167112 10:22991306-22991328 ACCCCCTAGCCAGTATCACAGGG + Intronic
1068639895 10:59391692-59391714 AGGCCCCACCCAGAATCAAAGGG - Intergenic
1069404328 10:68082177-68082199 CCGCCGCACCCAGCCTCAAAAGG - Intergenic
1069623214 10:69850631-69850653 CAGCCCCCCTCAGCATCACAAGG - Intronic
1069688783 10:70335976-70335998 CCGCCCCTCACATTATGACATGG + Intronic
1069872760 10:71543171-71543193 CGGCCCCACCCAGGAGTACAGGG + Intronic
1070690138 10:78518297-78518319 CGGCCCCACACATTATCCCAAGG - Intergenic
1072668094 10:97409065-97409087 CCACCACACCCAGCATCAAATGG - Intronic
1073421556 10:103427822-103427844 CCTCCCCACAGAGTATCTCATGG - Intronic
1075461579 10:122619983-122620005 CTGCCCCATCCAGTGACACATGG - Intronic
1075745909 10:124727367-124727389 CCAGGTCACCCAGTATCACAGGG + Intronic
1076282396 10:129259286-129259308 CCACCCAACCCAGTCTCCCATGG + Intergenic
1076560696 10:131361468-131361490 CAGCCCCACCCAGCCTCACCTGG + Intergenic
1077144938 11:1040519-1040541 CAGCCCCACCCAGCCACACAAGG - Intergenic
1084731428 11:71076102-71076124 CCTCCCCACCCAAGCTCACAGGG + Intronic
1091340089 11:134804551-134804573 CTGCCCAGCCCTGTATCACAGGG + Intergenic
1100367389 12:93934280-93934302 CCCCTCCACCCAGTATCTGAAGG + Intergenic
1100445530 12:94656430-94656452 CCCCCCCCCCCAGTGCCACATGG - Intergenic
1103327692 12:120132379-120132401 CCGCCCCTCCCTGCCTCACAGGG - Intronic
1103485730 12:121281458-121281480 CAGCCACACCCTGTCTCACATGG + Intronic
1105706756 13:22971971-22971993 CCGTCCCACCCAGACTCACACGG + Intergenic
1107833484 13:44395216-44395238 CCTCCCCACCAAGGCTCACAAGG - Intronic
1108501154 13:51071261-51071283 CAGCCTCACCCTGTCTCACACGG - Intergenic
1111792252 13:92872194-92872216 CTGCACCACTCAGTATCCCAGGG + Intronic
1117602507 14:57390406-57390428 CAGCCCCACCCACTAGCACGCGG + Intergenic
1122323040 14:100866933-100866955 CCTCCTCCCCCAGAATCACAGGG + Intergenic
1122398744 14:101454412-101454434 CCAACCCACCCAGGAACACAAGG + Intergenic
1123008738 14:105337024-105337046 CCGCACCACCCAGCATCACTGGG + Intronic
1128178054 15:65574429-65574451 CAGACCAACCCAGTATAACATGG + Intronic
1128227994 15:66015882-66015904 CCCACCCACACAGTAGCACAGGG - Intronic
1128335142 15:66780951-66780973 CCTCCCCACCCAGAATAACGCGG + Intronic
1132230953 15:100183939-100183961 CAGCGACACCCAGTAACACAGGG - Intronic
1132268932 15:100505762-100505784 CCGCCCACCCCAGCATCCCAGGG - Intronic
1132577470 16:670600-670622 CCGCCCCACCCAGCACCCCCTGG - Intronic
1132690519 16:1180065-1180087 CCGGCCCCCTCAGTATCACCCGG - Intronic
1137717636 16:50608476-50608498 CACCCCCACCCAGAGTCACAAGG - Intronic
1141824352 16:86468552-86468574 CCGCTCAAGCCAGGATCACAAGG + Intergenic
1142046787 16:87930601-87930623 CCTCCCCACCCAGCCTGACAGGG - Intronic
1142428625 16:90013910-90013932 CCGCCCCACCCAGTATCACACGG - Intronic
1144999956 17:19297575-19297597 CCCCCACACCCAGCACCACACGG - Intronic
1152069505 17:78127939-78127961 CGGCCCCACCCAGCCTAACACGG + Intronic
1152288160 17:79424277-79424299 CCGCCCGTCCCAGGAGCACAGGG + Intronic
1153327829 18:3839922-3839944 CAGCCCCACCCTGAATCACCAGG + Intronic
1157863359 18:51160975-51160997 CAGCCCCAACCAGTAGCACCAGG - Intergenic
1159915614 18:74185002-74185024 CCACCCCACCCAGGTTCTCATGG - Intergenic
1161560597 19:4970401-4970423 ACGCCCCAGCCAGAAACACATGG - Intronic
1162189812 19:8936068-8936090 CCATCCCACCCAGTATACCAGGG - Exonic
1164453918 19:28391088-28391110 CCGCCCCACTCAGCCTCCCAAGG + Intergenic
1167307820 19:48719306-48719328 CCTCCCCTCCCAGGATCCCAGGG - Intronic
925080612 2:1061239-1061261 GCGTCCAACCCAGGATCACACGG - Intronic
927696340 2:25242136-25242158 CTGCCCCACCCAGTAGCCCCTGG + Intronic
928371245 2:30741701-30741723 GCGCCCCACCCAGTGTCATCCGG - Intronic
931166876 2:59757978-59758000 CCCCCCCAGCCATTACCACAGGG - Intergenic
935056502 2:99572300-99572322 CCCCCCCACCTAGAAACACACGG + Intronic
942191286 2:173473121-173473143 CCACCCCACCTAGTAGCCCAAGG - Intergenic
946188663 2:217995885-217995907 CCAGCCCACCCAGCATCAGAGGG + Intronic
947986388 2:234451282-234451304 CAGCAGCACCCAGTCTCACAGGG + Intergenic
1168814393 20:727008-727030 CCACCCCACCCATTCACACAAGG + Intergenic
1168998987 20:2153288-2153310 CTGCCCCACCCTGTTTCACATGG + Intronic
1169461293 20:5798052-5798074 CAGCCCCAGCCAATATCACATGG - Intronic
1169909995 20:10640170-10640192 CCGCTCCACCCAGTCTCTCCAGG - Intronic
1174195864 20:48772406-48772428 ACGTCTCACCCAGTGTCACAGGG - Intronic
1175994048 20:62804592-62804614 TCGCCCCACCCCGTCTCGCAAGG - Intergenic
1179229493 21:39488682-39488704 TCTTCCCACCCAGTATGACAAGG - Intronic
1182539723 22:31032258-31032280 GCTCTCCACCCAGTAGCACAGGG - Intergenic
1185376800 22:50486472-50486494 CTGCCCCACCCAGAATCACGGGG + Intergenic
951778123 3:26333090-26333112 CTGCCCCACCAAGTAACTCAAGG + Intergenic
960240279 3:115332698-115332720 CTGCTACACCCATTATCACATGG + Intergenic
961490983 3:127256863-127256885 CCGCCCCACCCACCAGAACAGGG - Intergenic
962086441 3:132196682-132196704 CAGCCCCACCCCCTATAACAAGG + Intronic
968705811 4:2076884-2076906 CCACCCCACCCAGCAACAAAGGG - Intronic
972279717 4:37590394-37590416 CAGCCCCACCCAGGATGACAGGG + Exonic
976734400 4:88295836-88295858 CCGCTCCACGCAGTATCCCTTGG - Intergenic
977310893 4:95385973-95385995 CCTCCCCAACCAGTATCTCCTGG + Intronic
980834745 4:138177485-138177507 CCGCCCCCCCCACTTCCACAAGG + Intronic
982306352 4:153935217-153935239 CCACCACACCCAGTCTCACAGGG + Intergenic
985758892 5:1734658-1734680 CCGCCCCCACCAGAACCACAGGG - Intergenic
992029772 5:72709437-72709459 CAGCCCTGCCCAGGATCACAGGG + Intergenic
992759233 5:79936923-79936945 CTGCCCCACCCACCACCACACGG + Intergenic
996089627 5:119338270-119338292 CAGCCACCCCCAGTATGACAAGG + Intronic
996605017 5:125311658-125311680 CAGCCCCAGGGAGTATCACATGG + Intergenic
996923963 5:128800527-128800549 CAGCCCCACCCAGGAGGACAGGG + Intronic
997224593 5:132199407-132199429 CTGCCCCACTCAGTCTCACCAGG - Intronic
998592008 5:143488176-143488198 CAGCCCCAGCCAGTATCTCGAGG + Intergenic
1003760519 6:9173990-9174012 CCACCTCACTCAGTTTCACATGG + Intergenic
1019540753 7:1550030-1550052 CCACCCCACCCAGTGTCAGGGGG - Intronic
1019863921 7:3687095-3687117 ACACACCACCCTGTATCACATGG + Intronic
1020082529 7:5294530-5294552 TCTCCCCACCCCGTAACACATGG + Intronic
1021220420 7:17969545-17969567 CCTCCCCACCCACTTTCCCAGGG - Intergenic
1022444248 7:30456720-30456742 CTGCCCCACCCAGCCTGACAAGG - Exonic
1029545073 7:101206337-101206359 CCGCCTCACCCACTACCACGAGG - Exonic
1031630003 7:124033525-124033547 CCGCCGCACCGAGTCCCACAGGG + Intergenic
1035297362 7:157874642-157874664 CCGTGCCACCCAGCAGCACAAGG + Intronic
1035356800 7:158280557-158280579 CCTCTCCACCCGGTATCTCAGGG - Intronic
1037982648 8:23265431-23265453 CAGCCCTACCCAGTATCTCCTGG - Intergenic
1039442964 8:37608081-37608103 CCACCCCCCACAGTGTCACAAGG - Intergenic
1040580313 8:48693590-48693612 CCGCCCCACCCCAGCTCACAGGG - Intergenic
1041288999 8:56290619-56290641 CCGCCCCACCCACCATCTCCAGG - Intergenic
1042279545 8:67041111-67041133 CCCCCCCCCCCAGTTTCAGATGG - Intronic
1042652084 8:71054068-71054090 CAGCCCCAATCAGCATCACATGG + Intergenic
1042725238 8:71868205-71868227 CTGCTCCAGCCAGTGTCACAGGG - Intronic
1050635399 9:7607062-7607084 GTGCCACACCCAGGATCACATGG - Intergenic
1056713344 9:89009211-89009233 CAGCTCCACACAGGATCACAGGG - Intergenic
1057016578 9:91657657-91657679 ACGTCCCACCCAGCAGCACAGGG + Intronic
1061870269 9:133516693-133516715 CCACCGCACCCAGGGTCACACGG - Intronic
1190260593 X:48794410-48794432 CCGCCTCAGCCAGCCTCACATGG - Intergenic
1195020251 X:100819828-100819850 CCGCCCCACCACGAAGCACATGG + Intergenic
1197753936 X:129982349-129982371 CCTCCCCTCCCAGTGTCACCGGG + Intronic
1202281752 Y:23198255-23198277 CCACCCCACCCAGTAGTACAAGG + Intronic
1202284139 Y:23220264-23220286 CCACCCCACCCAGTAGTACAAGG - Intronic
1202433424 Y:24812640-24812662 CCACCCCACCCAGTAGTACAAGG + Intronic
1202435815 Y:24834650-24834672 CCACCCCACCCAGTAGTACAAGG - Intronic