ID: 1142429600

View in Genome Browser
Species Human (GRCh38)
Location 16:90019150-90019172
Sequence CCGCGCCCGGGAGGTGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 221}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142429589_1142429600 -3 Left 1142429589 16:90019130-90019152 CCCCCAGCCCCGCGCGGGGACCG 0: 1
1: 0
2: 3
3: 26
4: 236
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1142429590_1142429600 -4 Left 1142429590 16:90019131-90019153 CCCCAGCCCCGCGCGGGGACCGC 0: 1
1: 0
2: 1
3: 33
4: 247
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1142429592_1142429600 -6 Left 1142429592 16:90019133-90019155 CCAGCCCCGCGCGGGGACCGCGC 0: 1
1: 0
2: 3
3: 39
4: 330
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1142429593_1142429600 -10 Left 1142429593 16:90019137-90019159 CCCCGCGCGGGGACCGCGCCCGG 0: 1
1: 0
2: 4
3: 22
4: 223
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1142429585_1142429600 4 Left 1142429585 16:90019123-90019145 CCGTGTGCCCCCAGCCCCGCGCG 0: 1
1: 0
2: 4
3: 37
4: 354
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221
1142429591_1142429600 -5 Left 1142429591 16:90019132-90019154 CCCAGCCCCGCGCGGGGACCGCG 0: 1
1: 0
2: 2
3: 24
4: 218
Right 1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142429600 Original CRISPR CCGCGCCCGGGAGGTGCCCC TGG Intronic
900003666 1:29717-29739 CCTCGCCCGGGGTGCGCCCCGGG + Intergenic
900269277 1:1778749-1778771 CCGCGTCCGGAGGGCGCCCCCGG + Intronic
900408793 1:2503757-2503779 CCGCGCCCGGGGGATGCCTCGGG + Intronic
901109462 1:6784349-6784371 GGGCGCCCGCCAGGTGCCCCGGG - Intergenic
901762520 1:11479948-11479970 CCGCGCGCGCGAGGGTCCCCAGG + Intronic
903182627 1:21612683-21612705 CCTCTTCCAGGAGGTGCCCCTGG + Intronic
903822081 1:26111051-26111073 CCACGCCGAGGAGGTGGCCCTGG + Intergenic
905626099 1:39491514-39491536 CCGCGCCCGCTAGGAGCCCCGGG - Intergenic
905741361 1:40374004-40374026 CCCCGCTCAGGAGGTGCCCCTGG + Exonic
911208698 1:95117783-95117805 CGGCGCGCGGGAGGCGGCCCGGG + Intronic
913222038 1:116667572-116667594 CGGCGCCCGGAGGGGGCCCCGGG - Intronic
915495947 1:156282692-156282714 CTGTGACCGGGAGCTGCCCCCGG - Exonic
917975269 1:180233942-180233964 ACGCACCCCGGAGGAGCCCCAGG - Intronic
918001685 1:180502806-180502828 CCGCCACCGGGATGGGCCCCCGG + Exonic
920385466 1:205568236-205568258 CCGCGTCCTGGAGGAACCCCGGG - Intergenic
924561106 1:245156662-245156684 CCTTGCCCGGGAAGGGCCCCGGG - Exonic
1070290764 10:75111821-75111843 CCGCGACCTGGAGGGGCCCCGGG + Intronic
1070800907 10:79243787-79243809 CCGCGCCCGGAGGGAGCCCAGGG - Intronic
1071500687 10:86202167-86202189 CCGTGCCCTGGAGATGCCCCTGG + Intronic
1072926308 10:99620264-99620286 CAGGGCCCGGGCGGAGCCCCGGG - Exonic
1072994280 10:100229499-100229521 CCGCGCCCGGCCGCAGCCCCGGG + Exonic
1073057205 10:100710334-100710356 CGGCGCCCGGGAGGAGCCGCGGG - Intergenic
1075287841 10:121202535-121202557 CCGCTCCCCAGAGGGGCCCCAGG + Intergenic
1076750050 10:132537957-132537979 CCGAGCCCGCGATGCGCCCCGGG + Exonic
1076827279 10:132975369-132975391 CTGCGCCGGGGATGTGCACCGGG - Intergenic
1076872668 10:133201356-133201378 CCGTGCCCGGGGGGCGCCCGTGG + Intronic
1076919949 10:133446209-133446231 TCGCGCCCGGAAGCTGCCCCGGG - Intergenic
1077005890 11:355974-355996 CGGCGCCCGGGAGGCCTCCCAGG + Intergenic
1077024722 11:433993-434015 TGGGGCCCGGGAGGGGCCCCCGG + Intronic
1077514347 11:2992578-2992600 CCGCTCCCGGGACCTTCCCCGGG + Intergenic
1078023524 11:7673758-7673780 CCGCGGCGGGGAGCGGCCCCCGG - Exonic
1078317572 11:10305618-10305640 CCCCGCCCGGGCGGTGCAGCTGG + Exonic
1078771779 11:14358651-14358673 CCGGGCCCGCGAGGCGCCTCTGG + Intronic
1079071801 11:17353543-17353565 CCGGGCCCGGGAGGGGGCGCGGG - Intronic
1079362023 11:19777339-19777361 CCGCGGCCGAGAGGAGACCCGGG + Intronic
1080551431 11:33376476-33376498 CCGCGCCCGGGGCGGGCTCCAGG - Intergenic
1080802234 11:35619083-35619105 CGGCGCCCGGATGGTGGCCCTGG + Exonic
1082242465 11:49887355-49887377 CTGCTCCCAGGAGGAGCCCCGGG + Intergenic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1083941977 11:65900661-65900683 CCGCGCCCAGGTGGAGCCCCGGG + Intergenic
1084193263 11:67508490-67508512 CCGCGCCCGGGAAGACCCCTCGG - Exonic
1084310171 11:68312392-68312414 CCCTGCCCTGGAGGTGCCTCCGG - Intergenic
1084888488 11:72225006-72225028 CCGGGCCCGGGGGGCGCCCTGGG + Exonic
1085010846 11:73141211-73141233 CCGGGCCCGGGAGGTGCGTGGGG - Intronic
1090190297 11:124762403-124762425 CCGCGCGCTGGGGGCGCCCCCGG - Intergenic
1091550019 12:1530199-1530221 CAGCGCCTGGGAGGAGCCCTCGG + Intronic
1094831508 12:34302408-34302430 CAGCTCCTGTGAGGTGCCCCGGG + Intergenic
1095440958 12:42238307-42238329 CCGCGCTCGGGAGCCGCCGCCGG + Intronic
1102197231 12:111034263-111034285 GCGCGGCCGTGAGGAGCCCCCGG + Intronic
1103276032 12:119712548-119712570 CCCCGCCCTGGAGGTGGGCCGGG - Intronic
1104989665 12:132618642-132618664 CCCCGCCCCGCAGGTGTCCCGGG - Intergenic
1108484401 13:50909936-50909958 CAGCGCCCGGGAGGAGGCCCAGG - Exonic
1108541716 13:51452381-51452403 CCGAGCCCGGGCGGCGACCCCGG - Intronic
1112091654 13:96090332-96090354 CCGCGCCCGGCACGCGCGCCCGG - Intergenic
1114460998 14:22886206-22886228 CCGCTCCCGGGAGGTATCACTGG + Exonic
1117899320 14:60515840-60515862 CCGCGCCCGACAGGTCCGCCGGG + Intergenic
1118752386 14:68816566-68816588 CCGCGCCGGGGAGGAGATCCCGG - Intergenic
1119260990 14:73237931-73237953 CCCCTCCCGGGAGGTGCCACTGG + Intronic
1121539445 14:94714042-94714064 CAGCACCCAGGAGGTGCCCCTGG + Intergenic
1122599125 14:102912556-102912578 TGGCTCCCGGGAGCTGCCCCAGG + Intergenic
1123450436 15:20356606-20356628 CCCAGCCCTGGAGGTGCCCTCGG - Intergenic
1123973647 15:25532077-25532099 GCGGACTCGGGAGGTGCCCCAGG - Intergenic
1124612116 15:31215900-31215922 CCGCGCCTGGGAGAGGCCTCCGG + Intergenic
1128384176 15:67135303-67135325 CTGGGCCCGGGGGCTGCCCCTGG - Intronic
1129200467 15:73995329-73995351 CCGTGCCTGGGACATGCCCCTGG - Intronic
1129741991 15:77993721-77993743 CAGGCCCAGGGAGGTGCCCCTGG - Intronic
1130258090 15:82335052-82335074 CAGAGCCAGGGAGGTGCCCATGG - Intergenic
1130596841 15:85254911-85254933 CAGAGCCAGGGAGGTGCCCCTGG + Intergenic
1130894221 15:88157998-88158020 CCGGGCCCGTGAGGTGCCAAAGG - Intronic
1131091646 15:89628652-89628674 CCGCACCCGGGAGGAGACGCGGG - Exonic
1131118081 15:89806523-89806545 CCACGCCCAGGAGGATCCCCAGG + Exonic
1132449836 15:101961223-101961245 CCTCGCCCGGGGTGCGCCCCGGG - Intergenic
1132468888 16:90714-90736 CCCCTCCCAGGAGGTGACCCTGG - Intronic
1132849137 16:2016630-2016652 ACGCCCCCTGGAGGTGGCCCGGG - Intronic
1132889322 16:2196281-2196303 CCGCGCCGGGGAGGGGCCCCCGG + Intronic
1132994744 16:2817196-2817218 CCGCCCCCAGGGGGCGCCCCGGG + Intronic
1133059010 16:3162151-3162173 TTGAACCCGGGAGGTGCCCCTGG + Intergenic
1133287773 16:4698488-4698510 CCGCGCCCGCGAGGACCTCCAGG - Exonic
1135582613 16:23641230-23641252 CTGGGCCGGGGAGGCGCCCCAGG + Exonic
1137426385 16:48384861-48384883 GCGCGCCCGGGAGGCGGGCCCGG - Intronic
1139467330 16:67160962-67160984 CCTCGCCGGGGAGATGTCCCGGG - Intronic
1141642526 16:85349552-85349574 GCCAGCCCGGGAGGTGCTCCTGG + Intergenic
1142173273 16:88633886-88633908 CCCCTCCCAGGGGGTGCCCCAGG + Intergenic
1142429600 16:90019150-90019172 CCGCGCCCGGGAGGTGCCCCTGG + Intronic
1142586553 17:978555-978577 CCGCGCCCGGGAGGCGTCTGGGG + Intronic
1142815521 17:2422019-2422041 CCGCGCCCGGCAGGTGCCATTGG - Intronic
1143863603 17:9908457-9908479 CTGTGCCCAGGAGGGGCCCCAGG + Intergenic
1144768535 17:17746180-17746202 CCAAGCCCGGCAGATGCCCCCGG + Intronic
1145264124 17:21371392-21371414 CTGGGCCCTGGGGGTGCCCCAGG + Intergenic
1145912900 17:28552642-28552664 CCGCCCCCGGCCGGGGCCCCAGG + Exonic
1148323700 17:46771690-46771712 CCGCGGCCGGGCCGCGCCCCCGG + Intronic
1148437261 17:47694233-47694255 CGGCGCCCGGGCTGGGCCCCAGG + Intronic
1148565803 17:48632246-48632268 CAGGGCCAGGGAGGTGCCTCGGG + Intronic
1148646872 17:49224299-49224321 CCGCGCCAGCGTGGTGCCCTGGG - Exonic
1149891247 17:60392087-60392109 CGGCGACCGGGAGGAGCCGCCGG - Exonic
1152066955 17:78117376-78117398 CCGCTCCCGGGCTGTGGCCCTGG - Intronic
1152068610 17:78124523-78124545 CCGCGCCTGTGAGGAGCTCCAGG + Exonic
1152110017 17:78352849-78352871 CCACCCCAGGGAGGTGCGCCTGG + Intergenic
1152242497 17:79167792-79167814 ACGGGGCCTGGAGGTGCCCCCGG + Intronic
1152338006 17:79708733-79708755 CCCAGCCCTGGAGGTGCCCTCGG + Intergenic
1152433073 17:80260431-80260453 CAGCCCCCGGGAGGCGCCTCGGG - Intergenic
1152596172 17:81238864-81238886 CCGCGCCGGGTAGCTGCTCCTGG - Intronic
1152733908 17:81987436-81987458 CCTGGGCCGGGCGGTGCCCCCGG + Intronic
1152943455 17:83185204-83185226 CCTGGCCTGGGAAGTGCCCCGGG - Intergenic
1156245141 18:35290496-35290518 CCGTGCCCGGGAGCGACCCCGGG - Intergenic
1160455233 18:78994757-78994779 GGGCGCCCCGGAGGAGCCCCAGG + Exonic
1160499730 18:79395794-79395816 CCGGGCCCGCGCGGGGCCCCGGG - Intergenic
1160631251 18:80247529-80247551 CCGCGCGCGGGAGGAGCGCGGGG + Exonic
1160635419 19:71324-71346 CCTCGCCCGGGGTGCGCCCCGGG + Intergenic
1160672693 19:373764-373786 CTGCTCCCAGGAGGTGGCCCTGG - Intronic
1160708920 19:541861-541883 CCGCACCCCGGAGGAGCCACGGG + Exonic
1160813924 19:1026801-1026823 CCCTGCCCGGGAGGTGCCGGGGG - Intronic
1160857916 19:1225726-1225748 CTTCGCCCGGGAGGGGCCTCGGG + Intronic
1160873230 19:1286319-1286341 CCGCGCGCGGGGGGCGCCCGGGG + Intronic
1160930294 19:1567110-1567132 CCCCGCCCGGCCGGAGCCCCGGG + Intronic
1160947981 19:1652290-1652312 CCGCGCCCAGCAGGTGAGCCCGG - Exonic
1160988717 19:1851993-1852015 CCGCGCCGGCGAGCAGCCCCGGG + Intergenic
1160995596 19:1880744-1880766 CCCAGCACGGGAGCTGCCCCAGG + Intronic
1161054150 19:2181518-2181540 CCTGGCCAGGGAGGTGCCGCTGG - Intronic
1161521063 19:4723717-4723739 CCGCGACCGTGAGGCGCCGCTGG - Exonic
1162766670 19:12924150-12924172 CCGCTCCAGGGAGAGGCCCCAGG + Exonic
1163012407 19:14433946-14433968 CTGCGCCAGGCACGTGCCCCAGG - Intronic
1163153464 19:15428048-15428070 CCCCCCCCGGGAGGGGCTCCAGG + Intronic
1164039590 19:21483339-21483361 CCGGGCCTGGGGGGTGTCCCCGG - Intronic
1164673661 19:30087980-30088002 CACCTCCCGGGAGGAGCCCCGGG + Intergenic
1165129506 19:33622925-33622947 CCGCCCCCTGGAGCCGCCCCAGG - Intronic
1165787976 19:38473681-38473703 CCCCGCCTGCGGGGTGCCCCCGG - Exonic
1166442100 19:42823906-42823928 CAGGGCCCGGGAGGAACCCCGGG + Intronic
1166461524 19:42992189-42992211 CAGGGCCCGGGAGGAACCCCGGG + Intronic
1166478817 19:43152174-43152196 CAGGGCCCGGGAGGAACCCCGGG + Intronic
1166501490 19:43344505-43344527 CAGGGCCCGGGAGGAACCCCGGG + Intergenic
1166508626 19:43388953-43388975 CAGGGCCCGGGAGGAACCCCGGG - Intergenic
1167291589 19:48627985-48628007 CCACGCCCGGGAGCTGGTCCAGG + Exonic
1167357442 19:49012500-49012522 CCTCCCACAGGAGGTGCCCCTGG - Intronic
1167758208 19:51426524-51426546 CCGGGTCCTGGAGCTGCCCCAGG - Intergenic
1167885005 19:52493180-52493202 CCGAGCCTGGGAGGCGCCCAGGG - Intronic
1167909398 19:52689884-52689906 CCGCGTTGGGGAGGTGCCCGGGG - Intronic
1167940410 19:52942089-52942111 CCGCGTTGGGGAGGTGCCCGGGG - Intronic
1167946436 19:52992743-52992765 CCGCGTTGGGGAGGTGCCCAGGG - Intergenic
1167952278 19:53037305-53037327 CCGCGTTAGGGAGGTGCCCAGGG - Intergenic
1167955073 19:53057960-53057982 CCGCGTTGGGGAGGTGCCCGGGG - Intergenic
1167964476 19:53132355-53132377 CCGCGCTGGGGAGGTGCTCAGGG - Intronic
1167967287 19:53158175-53158197 CCGCGCTGGGGAGGTGCCCGGGG - Intronic
1167987949 19:53334223-53334245 CCGCGTTGGGGAGGTGCCCGGGG + Intronic
1167999406 19:53432532-53432554 CCGCGTTGGGGAGGTGCCCGGGG + Intronic
1168577827 19:57527790-57527812 CAGAGCCTGGGAGGTGCGCCGGG + Intronic
925302556 2:2827504-2827526 CCAGGCCCGGGAGCTGCCCCAGG - Intergenic
926131227 2:10304116-10304138 CGCCGCCCGGGAGGTGCTGCAGG - Intronic
926268319 2:11345113-11345135 CGGCGCCCGCGAGGGGCCGCAGG + Intronic
927490191 2:23516239-23516261 CCGGGCCCAGCAGGTGCCCATGG - Intronic
929218224 2:39437501-39437523 CCGCGCCCGGCCGCTGCCGCCGG + Intergenic
929967817 2:46548662-46548684 CAGAGCCTGGGAGGAGCCCCAGG + Intronic
932288299 2:70554368-70554390 CCCCGCCCCAGAGATGCCCCAGG - Intergenic
932327334 2:70871829-70871851 CAGGGACCGGGACGTGCCCCTGG - Intergenic
936433204 2:112482063-112482085 CCGCGCTCTGGAGGAGCCCGTGG - Intergenic
937987601 2:127645462-127645484 CCACCCCAGGGAGGAGCCCCAGG + Intronic
938583864 2:132670472-132670494 CCGCACCCGGCAGGTCCCCACGG - Intronic
939630849 2:144524467-144524489 CCGCGGCCGGGAGGTGATGCCGG + Intronic
945032909 2:205682151-205682173 GCGCGCCCTGGGGGTGCCCGGGG + Intronic
945235005 2:207625409-207625431 CAGCCTCCGGCAGGTGCCCCCGG + Intronic
1169129470 20:3158003-3158025 CCTCGCCCGGGAGGTTGCCGGGG - Intronic
1171452832 20:25248014-25248036 CCGCGCCGGGGCGGGGCCTCGGG - Intergenic
1173672993 20:44810685-44810707 CCGGGCCCGGCAGGTGCGCGCGG + Intergenic
1173691800 20:44966596-44966618 CCGCGCCGGTGAGGGGCCACTGG + Exonic
1173896486 20:46554894-46554916 CTGCACCCGGGAGGTGGACCTGG + Intergenic
1174357782 20:50009959-50009981 CCGCGGCCTGGAGGGGCGCCCGG - Intergenic
1175414934 20:58794939-58794961 CTGGGCCCAGGAGGGGCCCCTGG - Intergenic
1176001221 20:62832151-62832173 CAGGGTCCGGGAGGTGCCGCAGG + Exonic
1176042373 20:63072333-63072355 CCGCGCCCCGCTGCTGCCCCCGG - Intergenic
1176237940 20:64062977-64062999 CCCCGCGAGGGAGGCGCCCCGGG - Intronic
1176381710 21:6117081-6117103 CAGCGCCAGGGCGGTGCCCCCGG - Intronic
1176952759 21:15065325-15065347 GCGCGCCCGGGCCGTCCCCCGGG + Intergenic
1178707679 21:34888946-34888968 CCGCACGCGGGCGGGGCCCCGGG - Intronic
1178916840 21:36709514-36709536 CCACGCTCGGGAGGCGCCCCTGG - Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179718555 21:43302614-43302636 CCCCGTCCTGGGGGTGCCCCAGG + Intergenic
1179741762 21:43421158-43421180 CAGCGCCAGGGCGGTGCCCCCGG + Intronic
1180091373 21:45535255-45535277 CCGAGTCCGTGAGGTGCTCCTGG - Intronic
1180190082 21:46158777-46158799 CAGGGCCCGGGTGCTGCCCCAGG + Intergenic
1181044898 22:20209856-20209878 CAGCTCCTGGGAGCTGCCCCGGG - Intergenic
1184017922 22:41800030-41800052 TCCCGCCCGGCAGGGGCCCCGGG + Intergenic
1184409286 22:44317348-44317370 CCGCGCCCAGGAGGACTCCCTGG + Intergenic
1185282047 22:49976268-49976290 GCCTGCCCTGGAGGTGCCCCCGG - Intergenic
949540129 3:5026357-5026379 CCGCCCCCGGGAAGTGACCCGGG - Intergenic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
950940144 3:16884266-16884288 CCCCCTCCGGGAGCTGCCCCGGG + Intronic
956414574 3:69013253-69013275 GCGCGCCTGGGAGGGGCCCCGGG + Intronic
956681350 3:71784900-71784922 GCGCGCCTGGGATGTGCCCAGGG - Intronic
959849805 3:111072325-111072347 CCGCGCCCGGGGCGAGGCCCTGG + Intronic
961013350 3:123449645-123449667 CGGCGCCCGAGAGGCGCTCCGGG + Exonic
961202457 3:125055740-125055762 CCGCTCCCGCGAGGGGCGCCAGG + Exonic
968965171 4:3766010-3766032 CCGCGCCCGGGAGCAGCCGGAGG + Intergenic
968995397 4:3942141-3942163 AAGAGGCCGGGAGGTGCCCCAGG + Intergenic
977557288 4:98498707-98498729 GAGCTCCCGGGAGGTGCCCTTGG - Intronic
982357945 4:154490329-154490351 CCGCGCCCGGCAAGTGCCTGGGG - Intronic
984734839 4:183099324-183099346 CCACGCGCGGGAGGTGCCTCAGG - Exonic
985643710 5:1075284-1075306 CCCCTCCAGGGAGCTGCCCCAGG + Intronic
985688262 5:1293589-1293611 CTGTGCCCGGGAGAAGCCCCAGG - Exonic
988469629 5:31526514-31526536 CCTTGTCCAGGAGGTGCCCCAGG + Exonic
991643470 5:68777158-68777180 CTGTCCCCTGGAGGTGCCCCAGG - Intergenic
999610386 5:153362738-153362760 CAGCTCCCAGGAGGTGCCCAAGG - Intergenic
1002062016 5:176630630-176630652 GCGGGCCCGGGACGCGCCCCTGG + Intergenic
1002071322 5:176680355-176680377 CCGCGCCCGGGAGCCGGCCCAGG - Intergenic
1002185960 5:177454935-177454957 CCGCGGCCGGGGGCTGCCCGTGG - Exonic
1002570383 5:180136536-180136558 CCGCGCTCGTGAGGGGCGCCGGG + Intronic
1006844103 6:37050720-37050742 ACGTGCCCGTGAGGTCCCCCAGG - Intergenic
1007665187 6:43509606-43509628 CTGCGCCAGGGACGTGGCCCCGG + Exonic
1009888654 6:69655199-69655221 CCGGGCAGGGGAGGTTCCCCTGG - Intergenic
1012912773 6:105136749-105136771 CCGCGCCCTCGAGGGGCTCCCGG - Intronic
1016990631 6:149925678-149925700 CCGCTCCCGGACGATGCCCCTGG + Intergenic
1017905037 6:158752067-158752089 CCGAGCCCGGGTGGAGCGCCTGG + Intronic
1019016902 6:168886447-168886469 CTGTGGCCGGGAGGTGGCCCCGG + Intergenic
1019298516 7:291210-291232 CCGCGCGCGGGGGGCGCCCAGGG + Intergenic
1019379179 7:712355-712377 CCGGGCCTGGGAGGCCCCCCGGG - Intronic
1019743861 7:2688708-2688730 CGGCGCCCTGGAGGTTCCCCGGG - Intronic
1020136892 7:5592708-5592730 CTCCGCGCGGGAGGGGCCCCGGG - Intergenic
1020383010 7:7566834-7566856 CCCCGCCCGGGAGGCGCCTCGGG - Intergenic
1024226936 7:47332523-47332545 CCCAGCCCGCGAGCTGCCCCAGG + Intronic
1027152110 7:75739745-75739767 CAGGTCCCGGGAGGTGCCCGCGG - Intergenic
1029479121 7:100802326-100802348 CCCCACCCCGGAGGTGCCCCAGG + Intergenic
1032487740 7:132300730-132300752 CCCCAGCTGGGAGGTGCCCCTGG + Intronic
1033361189 7:140640303-140640325 CCGAGCCCGGGAGGAACGCCTGG + Intronic
1034306457 7:150048357-150048379 CCGCGCCCGGGACTGGCGCCTGG + Intergenic
1034306621 7:150048913-150048935 CAGCGCCCGCGAGGGGCGCCTGG - Intergenic
1034313787 7:150111718-150111740 CAGCGCCCGCGAGGTGCTGCTGG - Intergenic
1034793111 7:153989074-153989096 CAGCGCCCGCGAGGTGCTGCTGG + Intronic
1034800389 7:154052285-154052307 CCGCGCCCGGGACTGGCACCTGG - Intronic
1035687745 8:1538066-1538088 CCGAGCCCTGCAGGTGCCCCAGG - Intronic
1038359723 8:26865003-26865025 GCCAGCCCGGGAGGTGGCCCTGG - Exonic
1038450085 8:27634110-27634132 CCGCGCCCTGGAGGATCCGCCGG + Intronic
1041502412 8:58553333-58553355 CCGCGCCCGGGACCTGGCACCGG - Intronic
1042894400 8:73651135-73651157 CCGGGCCAGGGAGGCTCCCCAGG - Intronic
1048331002 8:133470799-133470821 CCGCTCTCGGGCCGTGCCCCTGG - Intronic
1049194100 8:141306174-141306196 CGAGGCCCGGGAGGTGGCCCTGG + Intronic
1049615137 8:143572666-143572688 CCGGGCCCGGGAGGCTCCCGTGG - Exonic
1049651419 8:143771561-143771583 CCGCCGCCGGGAGGAGCGCCGGG + Intergenic
1049769305 8:144372513-144372535 CCGGCTCCGGGAGGGGCCCCAGG + Intergenic
1049804781 8:144533920-144533942 CCGGGCCCAGGAAGAGCCCCCGG + Intronic
1049886362 9:29495-29517 CCTCGCCCGGGGTGCGCCCCGGG + Intergenic
1057054125 9:91948885-91948907 GCGCGGGCGGGAGGTGCTCCCGG + Intronic
1060599522 9:124868908-124868930 CCGCGCCTCCGAGGAGCCCCTGG - Exonic
1061559546 9:131393955-131393977 CCGCTCCCGGGAGGCGCGGCAGG + Intergenic
1061919732 9:133776222-133776244 CCTGGCCTGGGAGGTGCCCAAGG + Intronic
1061986965 9:134135617-134135639 CTGCGCCCGGGCGCGGCCCCAGG + Intronic
1062556362 9:137114886-137114908 CCGTGCCCGGGAAGGACCCCTGG - Intronic
1062558850 9:137130162-137130184 CCGCGCCCGGGTGAGGCCCTGGG - Intergenic
1186638114 X:11427678-11427700 TCGCGCCCAGGGGCTGCCCCAGG - Intronic
1187388901 X:18873054-18873076 CCGCAGGAGGGAGGTGCCCCTGG + Intergenic
1190265909 X:48827066-48827088 CCGCTCCCGGGAGGAGCCCGAGG - Intergenic
1200045144 X:153397095-153397117 CCGGGCTGGGGAGGAGCCCCAGG + Intergenic