ID: 1142431200

View in Genome Browser
Species Human (GRCh38)
Location 16:90028719-90028741
Sequence CCATGAGGGCAGAGGCCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 818
Summary {0: 1, 1: 0, 2: 2, 3: 80, 4: 735}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142431200_1142431207 5 Left 1142431200 16:90028719-90028741 CCCTCTGGCCTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 80
4: 735
Right 1142431207 16:90028747-90028769 TGCCTGTGAGCACCTGACATGGG 0: 1
1: 0
2: 3
3: 15
4: 221
1142431200_1142431206 4 Left 1142431200 16:90028719-90028741 CCCTCTGGCCTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 80
4: 735
Right 1142431206 16:90028746-90028768 CTGCCTGTGAGCACCTGACATGG 0: 1
1: 0
2: 1
3: 42
4: 227
1142431200_1142431209 13 Left 1142431200 16:90028719-90028741 CCCTCTGGCCTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 80
4: 735
Right 1142431209 16:90028755-90028777 AGCACCTGACATGGGACATGAGG 0: 1
1: 0
2: 0
3: 17
4: 207
1142431200_1142431210 14 Left 1142431200 16:90028719-90028741 CCCTCTGGCCTCTGCCCTCATGG 0: 1
1: 0
2: 2
3: 80
4: 735
Right 1142431210 16:90028756-90028778 GCACCTGACATGGGACATGAGGG 0: 1
1: 0
2: 0
3: 43
4: 871

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142431200 Original CRISPR CCATGAGGGCAGAGGCCAGA GGG (reversed) Intronic
900127629 1:1075519-1075541 CCAGGACTGCAGAGGCCAGGGGG + Intergenic
900131616 1:1089631-1089653 CCATGATGGAAGAACCCAGAAGG - Intronic
900178991 1:1303131-1303153 CCTTGAGGTCAGAGGTCAGTCGG + Intronic
900191269 1:1353308-1353330 CCCAGCGGGCAGAGCCCAGAAGG + Exonic
900286190 1:1901752-1901774 CCAAGAGGGCAGTGGGCAGGGGG - Intergenic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900745300 1:4356688-4356710 CCATGAGGGCAGATTCCCCAAGG - Intergenic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
901413837 1:9103778-9103800 CCATGGAGGGAGAGGCCAGGAGG + Exonic
901490010 1:9591852-9591874 CCAGCAGGGCAGACGGCAGAGGG - Intronic
902096068 1:13947044-13947066 CCATGGGGGCAGAGATCAGAGGG - Intergenic
902455638 1:16532159-16532181 CCATGAGGACAGACAGCAGAAGG - Intergenic
902496535 1:16875756-16875778 CCATGAGGACAGACAGCAGAAGG + Intronic
902546973 1:17196138-17196160 CCAAGAAGGATGAGGCCAGAGGG - Intergenic
902679584 1:18033619-18033641 CCATGGGGGCAGAGGCCTTGGGG + Intergenic
902876475 1:19343662-19343684 ACATGAGGCCAGAGCCCAGCTGG - Intronic
903023287 1:20409594-20409616 GCAAAAGGGCAGAGACCAGAAGG + Intergenic
903056783 1:20641662-20641684 CCAGGAGAGCAGAGGCTAGGAGG - Intronic
903672952 1:25047193-25047215 TCATGAGGGGAGAGGCTGGATGG - Intergenic
904264593 1:29311072-29311094 CCATGAGGCCTGAGCCCAGCTGG - Intronic
904496690 1:30891228-30891250 CCATGGGGACAGAGGGCAGATGG - Intronic
905060614 1:35136387-35136409 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
905235331 1:36542514-36542536 CCCTGAGGGCAGATGGGAGATGG - Intergenic
905235621 1:36544526-36544548 CCCTGAGGGCAGATGAGAGATGG - Intergenic
905592047 1:39172694-39172716 CTAAGAGGGCACAGGCCTGATGG - Intronic
906080828 1:43087140-43087162 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
906209925 1:44007084-44007106 GCAGGTGAGCAGAGGCCAGAAGG - Intronic
906670592 1:47651439-47651461 CAAGGAAAGCAGAGGCCAGAGGG + Intergenic
906836092 1:49084719-49084741 GCAGGAGGGAAGAGGCCAAAAGG - Intronic
906874790 1:49525668-49525690 TCACCAGGGAAGAGGCCAGACGG + Intronic
906911304 1:49954352-49954374 TCATGAGGGCAGAGCCCTCATGG - Intronic
906958385 1:50396975-50396997 CCATTAGGGCAGAGTCCTCATGG + Intergenic
907262803 1:53234060-53234082 CCTTGAGGGCAGAGGCCCCAGGG + Intronic
907291995 1:53421193-53421215 TCATGAGGGCAGAGCCCTCATGG + Intergenic
907525272 1:55050264-55050286 CAAGGTGGGCAGAGGCCAGATGG - Intronic
907665055 1:56427301-56427323 CCATGAGGCCAAAGACCAGTGGG + Intergenic
907979692 1:59469473-59469495 TCATGAGGGCAGAGCCCTCATGG + Intronic
908126814 1:61040332-61040354 CCATCAGCTCAGAGACCAGAGGG + Intronic
908427434 1:64021104-64021126 CAATTAGGGCAGAGGCTAGGAGG - Intronic
909222744 1:72983876-72983898 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
910443816 1:87280565-87280587 CCATCAGGGCAGCTGCCTGAGGG + Intergenic
911803046 1:102168259-102168281 CCATGAGGGCAGACCCCTCATGG - Intergenic
912188785 1:107313570-107313592 CTAGGAGGGAAGAGGCCAAAGGG + Intronic
912779126 1:112527474-112527496 CCATGAGGCCACACACCAGATGG + Intronic
912839635 1:113027681-113027703 CCCTGAGGGCTGAGGGCTGAGGG + Intergenic
913034762 1:114953107-114953129 CCATAAGGGCAGAGCCCTCATGG + Intronic
913083573 1:115413028-115413050 CCAGGAGAGCAGAGCCCAAATGG + Intergenic
913099664 1:115551419-115551441 TCATGATGGCAGAGCCCACATGG - Intergenic
913100545 1:115560141-115560163 CCATGAGGGGAAAAGCCAGCTGG + Intergenic
913539532 1:119805512-119805534 CCATGAAAGCAGAGGGCCGAGGG + Intronic
915222455 1:154385769-154385791 CCCTGAGGGCAGAGGGCGTAGGG + Intergenic
915458577 1:156055736-156055758 CCATGAGGGGAGCGGGGAGAGGG - Intronic
915776844 1:158499702-158499724 CTAAGAGGGCAGAATCCAGAAGG - Intergenic
916637999 1:166694800-166694822 CCATGAAGGCAGAAGTCAGATGG - Intergenic
916801285 1:168218958-168218980 TCATGAGGGCAGAGTCCTCATGG + Intergenic
917106588 1:171498438-171498460 CTGTGAGGGCAGAGCCCACATGG + Intronic
917461509 1:175234490-175234512 CCATCAGGAGGGAGGCCAGAAGG + Intergenic
917470358 1:175321334-175321356 CCATGAGGTCCGAGGCCTGATGG + Exonic
917851817 1:179070854-179070876 CCATGAGGGCAGAGCACTCATGG + Intronic
918215974 1:182392032-182392054 CCGGGAGGGCTGAGGGCAGAGGG + Exonic
918389883 1:184048062-184048084 ACATGTGGGCAGATGCAAGAAGG - Intergenic
918714498 1:187769542-187769564 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
918740625 1:188126781-188126803 CAATGAGGGCAGAGCCCTCATGG + Intergenic
918913469 1:190604378-190604400 CAATGATGGCAGAAGCCAAAGGG - Intergenic
919452138 1:197785393-197785415 CCATGAGGGCAGAAACTATATGG - Intergenic
920275419 1:204800843-204800865 TCATGAGGGCAGAGTCCTCATGG - Intergenic
920415714 1:205798052-205798074 CTGAGAGGGCAGAGGTCAGAAGG + Intronic
921937279 1:220806814-220806836 CCATGAGGGCCTAGGCCACCTGG + Intronic
922025683 1:221746453-221746475 TCATGAGGGCAGAGGCCTCATGG + Intergenic
922048324 1:221967621-221967643 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
922107012 1:222521318-222521340 CCGTGAGGCTAGAGGCAAGAGGG - Intergenic
922110318 1:222549259-222549281 TCATGAAGGCAGAGGCCTCATGG - Intergenic
922604504 1:226881087-226881109 AAGTGAGGGCAGAGTCCAGAAGG - Intronic
922619340 1:226980612-226980634 CCAAGAGGGCTGGGCCCAGAAGG - Intronic
923076684 1:230615625-230615647 CCATAAGGGCAGAGCCCTGATGG + Intergenic
923549955 1:234955598-234955620 CCCTGGGGGCAGGGGGCAGAGGG + Intergenic
923676922 1:236088312-236088334 TCATGAGGGCAGAGCCCTCATGG + Intergenic
923691939 1:236202739-236202761 CCATGATGGCAGTGCCCATAGGG + Intronic
924180566 1:241435624-241435646 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
924496424 1:244594789-244594811 CCATGCTGGCAGAGGCCTGCAGG - Intronic
924759667 1:246972048-246972070 CCCTGAGGGCAGGGGCCTGCTGG + Intronic
924793780 1:247277422-247277444 TCATGAGAGCAGAGGCCTCATGG + Intergenic
1062778061 10:172124-172146 TCATGAGGGCAGAGCCCCCATGG + Intronic
1063204826 10:3820919-3820941 CCATGGAGGCAGAGGACAGCAGG - Intergenic
1064137171 10:12761144-12761166 CCAAGAGGGCTGATGCCAGTGGG + Intronic
1064493281 10:15883000-15883022 CCAGGAAAGCAGAGGCCAGGAGG + Intergenic
1064643270 10:17435383-17435405 CCATGAGGGCAAAGACCATGAGG + Intronic
1065663425 10:28030912-28030934 TCATGAGGGCAGAGCCCTTATGG - Intergenic
1066167273 10:32801038-32801060 CCAAGATGGCAGAGGCCAAGCGG - Intronic
1067686201 10:48467088-48467110 CCAGGCAGGAAGAGGCCAGAAGG - Intronic
1068426234 10:56868177-56868199 CCATGAGGGCAGAGCCCTCATGG + Intergenic
1068447654 10:57143562-57143584 CAATAGGGGCAGAGGCCAGACGG - Intergenic
1068924146 10:62517393-62517415 ACAAGAGAGCACAGGCCAGAGGG - Intronic
1069898615 10:71694519-71694541 CCAGGAGGGCAGGTGGCAGAAGG + Intronic
1069924997 10:71843254-71843276 CCAAGAAGGAAGGGGCCAGAAGG + Intronic
1070657575 10:78282011-78282033 ACAAGAGGGCTGAGGCCAGGAGG - Intergenic
1070749477 10:78955484-78955506 CCATGAGGTCAGGGGTCAGCTGG - Intergenic
1070873227 10:79776859-79776881 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071640152 10:87299009-87299031 CCATGTGGGCAGTGGTCAGAGGG - Intergenic
1071655080 10:87438936-87438958 CCATGTGGGCAGTGGTCAGAGGG + Intergenic
1071916117 10:90296669-90296691 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1072738659 10:97896534-97896556 CCAAGAGGGGAGGGGTCAGATGG + Intronic
1073060952 10:100733320-100733342 GCCTGAGGGAGGAGGCCAGAGGG + Intergenic
1073098858 10:100996920-100996942 CTGTGAAGTCAGAGGCCAGAGGG + Intronic
1075248609 10:120846516-120846538 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1075374335 10:121965864-121965886 GCATGAGGGCAGAATCCAGAAGG - Intronic
1075859975 10:125667029-125667051 CCTTCAGGGCAGAGGCCTGCAGG + Intronic
1076374750 10:129975704-129975726 CCAAGGGGGCAGAGGCCTGGAGG + Intergenic
1076426928 10:130373610-130373632 CCAGGAGAGCAGTGGCCAGCAGG - Intergenic
1076471205 10:130719552-130719574 CCATCATGGCAGAAGGCAGAAGG - Intergenic
1076675824 10:132147311-132147333 TCATGAGGGCAGGGGCCACCAGG - Intronic
1076701405 10:132275150-132275172 CTGTCAGGGCTGAGGCCAGACGG - Intronic
1077235358 11:1479518-1479540 CCATGAGGGCAGGGCCCAGCAGG + Intronic
1077589968 11:3483708-3483730 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1077991224 11:7414117-7414139 CCTTGAGGGCAGAGATTAGACGG + Intronic
1078366288 11:10709112-10709134 CCATGAAAGCACAGGCCAAATGG - Intergenic
1079390794 11:20020426-20020448 CCATGAGGGCAGATGCCCTTTGG - Intronic
1079447374 11:20569454-20569476 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1079672658 11:23187986-23188008 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1080007302 11:27423461-27423483 CCATCAGAGCAGAGGGGAGAAGG - Intronic
1080150054 11:29041602-29041624 GCATGGGGGCAGAGTCCAGTGGG + Intergenic
1082004878 11:47413962-47413984 GCCAGAGGCCAGAGGCCAGAGGG - Intronic
1082793987 11:57366898-57366920 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082794368 11:57369096-57369118 CCATGAGGGCAGAGCCCGCAGGG + Intronic
1082810061 11:57474309-57474331 CGAAGAGGGCGGAAGCCAGATGG + Intronic
1083811608 11:65109677-65109699 CCAAGGAGGCAGAGGACAGAGGG - Intronic
1083860796 11:65418949-65418971 ACCTTAGGGCAGAGGCCTGAAGG + Intergenic
1084194689 11:67517820-67517842 CCATAAGGGCAGAGCCCTCATGG - Intergenic
1084422628 11:69067950-69067972 CGATGATGGCAGTGGTCAGAGGG + Intronic
1085007150 11:73102631-73102653 CTATGAGGGCAGAGCCCTCATGG - Intronic
1085122656 11:73977029-73977051 CCATGGGGTCAGTGGCCAGCGGG + Intronic
1085273755 11:75285316-75285338 CCTTGGGGGCAGAGTCCAGCTGG + Intronic
1085644766 11:78215891-78215913 CCATGGGAGAAGGGGCCAGAGGG + Exonic
1086125396 11:83344169-83344191 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1086134928 11:83435656-83435678 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1086136363 11:83446977-83446999 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1087011583 11:93519206-93519228 CCAGGAGGACAGTGGCAAGATGG + Intronic
1087130848 11:94668288-94668310 GCAAGGGGGCAGAGGCCAGGGGG - Intergenic
1087196823 11:95311196-95311218 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1087632341 11:100664962-100664984 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1087839630 11:102908152-102908174 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1088278584 11:108114984-108115006 CCATGAGGGCAGAGCCCTCGTGG - Intergenic
1088795147 11:113261259-113261281 CCAGGAGGAGACAGGCCAGAGGG + Intronic
1088896645 11:114083570-114083592 CTAAGAGGGCAGAGGGGAGAGGG - Intronic
1089195983 11:116694346-116694368 CCAAGAGGGCAGATCCAAGAGGG + Intergenic
1089196001 11:116694423-116694445 CCAAGAGGGCAGAGCCAAGAGGG + Intergenic
1089349009 11:117810947-117810969 CGAGGAGGGGAGAGGTCAGATGG - Intronic
1089381599 11:118036675-118036697 CCATGGGGGCAGAGGGTAGCAGG + Intergenic
1089867147 11:121642021-121642043 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1090066752 11:123510250-123510272 GCATGTGGGAAGAGGCCAGCTGG - Intergenic
1090280506 11:125452098-125452120 CCATAAGGGAAGAGGCCTGCTGG - Intronic
1090404295 11:126467781-126467803 CCTTGAGGCCAGAGGCCAGAGGG + Intronic
1090850689 11:130568410-130568432 CGAGGAGGGAAGAGGTCAGATGG + Intergenic
1091349617 11:134882451-134882473 CCATGAGGGCAGAAGCTTTATGG - Intergenic
1091364710 11:135007968-135007990 GAAAGAGGGCAGAGGGCAGAAGG + Intergenic
1091703928 12:2681079-2681101 TCATGAGGCCAGAGGGGAGAAGG - Intronic
1091710607 12:2737555-2737577 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1091713453 12:2759617-2759639 TCATGAGGCCAGAGGGGAGAAGG - Intergenic
1092275552 12:7058371-7058393 CTGTGAGGGTAGAGGCAAGATGG - Intronic
1092416265 12:8292613-8292635 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1092775657 12:11943299-11943321 CCTTGAAGGCAGAGGCCATGGGG - Intergenic
1093268099 12:17025745-17025767 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1093358344 12:18196594-18196616 CGAGGAGGGGAGAGGTCAGATGG - Intronic
1093558976 12:20515085-20515107 CCATGAGGGTAGAGCCCTCAGGG + Intronic
1093578727 12:20765042-20765064 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1093584608 12:20821048-20821070 CGAGGAGGGGAGAGGTCAGATGG + Intronic
1093959961 12:25261720-25261742 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1095190935 12:39257310-39257332 CCCTGAAGGCAGAGCTCAGAAGG + Intergenic
1095950981 12:47781845-47781867 CCAGGAGGGCCAAGGCAAGAGGG - Exonic
1096155875 12:49341378-49341400 CCGTGATGGCAGAGGCAGGAGGG - Intergenic
1096220252 12:49824546-49824568 CCAAGAGGGCAGAGGACGGTGGG + Intronic
1096907280 12:54947012-54947034 GGATGAGGGGAGAGGTCAGATGG + Intergenic
1097023642 12:56037655-56037677 CCATGAGAGCAGAGACTGGAAGG + Exonic
1097542286 12:60956057-60956079 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1097575362 12:61386474-61386496 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1098173730 12:67770694-67770716 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1100241404 12:92713492-92713514 CCAAGGTGGCAGAGGCCAGGTGG - Intergenic
1100940205 12:99716825-99716847 CGAGGAGGGGAGAGGTCAGATGG - Intronic
1101693800 12:107105864-107105886 CCATCTGTGCAGAGGCCAGTAGG - Intergenic
1101820904 12:108183721-108183743 CCCCGAGGTCAGAGGTCAGAGGG + Intronic
1101842553 12:108339030-108339052 CCTTCCGGGCAGAGACCAGAGGG - Exonic
1103214893 12:119194407-119194429 ACATCTGGGCAGAGGGCAGAAGG - Exonic
1104964769 12:132503959-132503981 CCATGGGGGCAGGGGGCTGAGGG - Intronic
1104970170 12:132527487-132527509 CCACGAGGGCTGAGGCCGCAGGG - Intronic
1105284514 13:18993454-18993476 CCAGGAGGCCAGAAGGCAGAAGG + Intergenic
1105284603 13:18993995-18994017 CCATTAAGCCAGAGGCCAAAAGG + Intergenic
1105285074 13:18996752-18996774 GCAGAAGGCCAGAGGCCAGAAGG + Intergenic
1105913276 13:24890983-24891005 ACATGAGGGTAGTGGCCATAGGG - Intronic
1106013532 13:25847085-25847107 CCCAGATGGCAGAGGCCACATGG - Intronic
1106161793 13:27207787-27207809 TCCTGAGGGCAGAGGCCTCATGG + Intergenic
1106663975 13:31832211-31832233 TCATGAGGGAATTGGCCAGAAGG - Intergenic
1107402975 13:40087163-40087185 CCAGGAGGGCAGAGACCAACAGG - Intergenic
1108202606 13:48058029-48058051 CAAGGAGGGGAGAGGTCAGATGG - Intronic
1108452798 13:50584477-50584499 CCATGAGGACAGAGCCCTCATGG + Intronic
1108489979 13:50971729-50971751 TCTTGAGGGCAGAGACCATATGG + Intronic
1108814041 13:54268522-54268544 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1109198626 13:59407002-59407024 ACTTGAGGGCAGAGGGTAGAAGG - Intergenic
1110650615 13:77937756-77937778 CGATGAGGGGAGAGGTCAGATGG + Intergenic
1110845248 13:80185308-80185330 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1111458932 13:88516870-88516892 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1112057005 13:95698685-95698707 ACATGAGGGCAGAGTCTTGATGG + Intronic
1112236738 13:97643972-97643994 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1113273483 13:108701345-108701367 TCATGAGGGCAGAGTCCTCATGG - Intronic
1113324246 13:109267009-109267031 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1113737610 13:112689849-112689871 CCCTGGGGGCAGAGGGCAGAGGG - Intergenic
1114417590 14:22554750-22554772 CAGTTAGGGCAGAGGTCAGAGGG + Intergenic
1114532291 14:23403512-23403534 CCATGGGGGCAGAGGGCAGGGGG + Intronic
1114569033 14:23652958-23652980 TCATGAGTGCAGAGCCCTGATGG - Intergenic
1115114651 14:29865448-29865470 TCATGAGGGCAGAGCCCTCAAGG - Intronic
1115240685 14:31249350-31249372 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1115840936 14:37469690-37469712 TCATGAGGGCAGAGCCCTCATGG - Intronic
1116565982 14:46444736-46444758 CCAGGAGACCAGAGGACAGAGGG - Intergenic
1116573368 14:46545592-46545614 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1116702497 14:48259456-48259478 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1116952826 14:50894836-50894858 CGAGGAGGGGAGAGGTCAGACGG - Intronic
1117660674 14:58001045-58001067 TCATAAGGGCAGAGGCAAAATGG - Exonic
1117958011 14:61137505-61137527 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1118476077 14:66118791-66118813 TAATGATGGCAGAGGCCATAAGG - Intergenic
1120251484 14:82065154-82065176 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1120930646 14:89844824-89844846 TCATGGGGCCTGAGGCCAGAGGG - Intronic
1121433076 14:93900917-93900939 CTATGAGGGCAGAGGCAAAATGG - Intergenic
1121552595 14:94813660-94813682 CCTTGTGGGTAGAGGCCAGGGGG + Intergenic
1122281544 14:100625745-100625767 CCATGAGGGCAGACCCCTCATGG - Intergenic
1122323474 14:100868961-100868983 CCAGGATGACAGAGGCCAGATGG - Intergenic
1122355741 14:101121958-101121980 CCGTCCTGGCAGAGGCCAGAAGG - Intergenic
1122549758 14:102543597-102543619 GGCTGAGGGCAGAGGCTAGAGGG - Intergenic
1122555223 14:102575267-102575289 TCATGAGGGCAGAGCCCTCACGG - Intergenic
1122781683 14:104146427-104146449 TCCTGAGGGCGGAGGCCAGGAGG + Intronic
1123830863 15:24135991-24136013 CCATGATGGCAGAGGTGGGAGGG - Intergenic
1123835941 15:24193364-24193386 CCATGATGGCAGAGGTGGGAGGG - Intergenic
1124008033 15:25810295-25810317 CCGAGAGGGCAGAGCCCACAGGG + Intronic
1124217189 15:27817071-27817093 CCAGGAGCGCAGAGCCTAGAGGG - Intronic
1124431138 15:29609437-29609459 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1124477719 15:30049411-30049433 CCATGAGGGCAGAGCCCCCATGG + Intergenic
1125382011 15:39095960-39095982 CCATGAGGGCAAATGGTAGATGG + Intergenic
1126890963 15:53203746-53203768 TCTGGAGGTCAGAGGCCAGAGGG - Intergenic
1127860825 15:62993042-62993064 CCTCAAGGGCAGAGGCCATAAGG - Intergenic
1128086828 15:64892521-64892543 TCATGAGGGCAGAGTCCTCATGG - Intronic
1129168088 15:73790602-73790624 TCATGAGGGCAGAGCCCTTATGG + Intergenic
1129259339 15:74355529-74355551 GGATGAGGGGAGAGGTCAGATGG - Intronic
1129370428 15:75090210-75090232 CCATGAGGACAGAGCCCTGGTGG + Intronic
1129798663 15:78397082-78397104 CCTAGAGGGCACTGGCCAGAGGG + Intergenic
1129882486 15:79016532-79016554 CCAGGAGGGCAGAGGCCTGGTGG + Intronic
1130047341 15:80455716-80455738 TCATGAAGGCTGAGGACAGAGGG + Intronic
1130883210 15:88072691-88072713 CCAAGAGGGCAGAGGTATGATGG + Intronic
1130884529 15:88081962-88081984 GAATGAGGGCAGAGCCCAGGGGG - Intronic
1130888141 15:88110906-88110928 CCATGTGGGAGGAGCCCAGATGG + Intronic
1130927867 15:88398622-88398644 CCATGGGGGCAGAGCCCTCAAGG - Intergenic
1131518853 15:93098467-93098489 TTATGAGGGCAGAGCCCACAAGG + Intergenic
1131688109 15:94793204-94793226 CCTGGAGAGCAGAGGCAAGAGGG - Intergenic
1131882605 15:96875878-96875900 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1132118296 15:99154418-99154440 GCATGAGGGCAGAGTCCTCATGG - Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1132877740 16:2147953-2147975 CCCTGAGGGCAGAGTCCCGTGGG + Intronic
1133028399 16:2998439-2998461 CACTGGGGGCAGAGGCTAGAAGG - Intergenic
1133029030 16:3000971-3000993 CCAGGAGGGCATAGGCAGGAAGG + Intergenic
1133389113 16:5394976-5394998 CAATGAAGGTACAGGCCAGAGGG - Intergenic
1133766812 16:8843865-8843887 CGAGGAGGGGAGAGGTCAGATGG + Intronic
1133846675 16:9460719-9460741 CCACGAGGTCTGAGGTCAGAAGG - Intergenic
1134089388 16:11383588-11383610 CCTGGAAGGCAGATGCCAGACGG + Intronic
1134108378 16:11499579-11499601 CCCTGCGGTCAGGGGCCAGAAGG + Intronic
1134810033 16:17159493-17159515 CCACGAGGACAGAGCCCAGCTGG + Intronic
1135933913 16:26762814-26762836 ACATGAGCCCAGAGGACAGAGGG + Intergenic
1136092627 16:27931376-27931398 CCATGAGGAGAAAGGCCAGTGGG - Intronic
1136252459 16:29014809-29014831 GCATGAGGGCAGAGTCCTCAGGG - Intergenic
1136409864 16:30069945-30069967 CCTTCAGGGCAGAGGCCTGCAGG - Exonic
1136516624 16:30772479-30772501 ATATGATGGCAGAGGCCAGAGGG + Intronic
1136674515 16:31890800-31890822 TCATGAGGGCAGAGTCCCAATGG + Intronic
1137567466 16:49542547-49542569 CCAGAAGGCCAGAGGCCAGGAGG + Intronic
1137683994 16:50373324-50373346 CCGTGTGGGCAGAGGCCATGTGG - Intergenic
1138396045 16:56705539-56705561 CCAGGAGGTCAGAGGCCAGCAGG + Intronic
1138457661 16:57130734-57130756 CCATTATGGCAGAGACAAGATGG + Intronic
1138695746 16:58811563-58811585 CCATGGGGACAGAGCCCACATGG + Intergenic
1138747769 16:59383415-59383437 TCATGAGGGCAGAGTCCTCATGG + Intergenic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1139654687 16:68380275-68380297 CCATGAGGGCATAGGACTGGCGG - Intronic
1139943140 16:70620508-70620530 CGAGGAGGGGAGAGGTCAGATGG + Intronic
1140021139 16:71239904-71239926 ACAGGAAGGCAGAGGCCAGTGGG + Intergenic
1140040419 16:71403821-71403843 CCCAGAGGGCAGAGGCCTAAGGG + Intergenic
1140861449 16:79022100-79022122 CCATGAGTGCAGAGGCACGTAGG + Intronic
1141592852 16:85080096-85080118 CCCAGAGGGCAGAGGGCAGAGGG + Intronic
1141725788 16:85787442-85787464 ACGTGAGGGCAAGGGCCAGAGGG + Intronic
1142003628 16:87678801-87678823 ACATGAGGGCAGAGGCCGAGAGG + Intronic
1142126807 16:88414511-88414533 CCGTGAGGGCAGAGGCCCCCAGG + Intergenic
1142431200 16:90028719-90028741 CCATGAGGGCAGAGGCCAGAGGG - Intronic
1142540477 17:654926-654948 CAGTGAGAGCAGCGGCCAGAGGG - Intronic
1142730537 17:1852532-1852554 GCCAGAGGGCAGAGGGCAGAGGG + Intronic
1143101213 17:4505826-4505848 CCAAGAGGGCAGAGGAAAGCGGG - Intronic
1143155987 17:4836352-4836374 CCATGTGTGGGGAGGCCAGATGG + Intronic
1143324568 17:6090411-6090433 CCATGAGTGCAAAGGCGAGAAGG + Exonic
1144104580 17:11973572-11973594 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1144201624 17:12947356-12947378 CCCTGTGGTCAGAGGCCAGAGGG - Intronic
1144201638 17:12947410-12947432 CCCCTAGGTCAGAGGCCAGAGGG - Intronic
1146570509 17:33948541-33948563 CCATGCAGTCAGAGGCCAGGTGG - Intronic
1146652433 17:34614906-34614928 CCATGGGAGCAGAGTCTAGAGGG + Intronic
1146826971 17:36031520-36031542 GCATGAGTGCAGGGGGCAGAGGG - Intergenic
1147141136 17:38461228-38461250 GCTTGAGGGCAGGGGCCAGGTGG - Intronic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147768861 17:42854378-42854400 AGATGGGGGCAGAGTCCAGAGGG + Intronic
1148054750 17:44787406-44787428 GCATGAGGGAAGAGGCCATCAGG - Intergenic
1149040376 17:52181521-52181543 GCATGGAGGCAGAGGCAAGATGG + Intergenic
1149298491 17:55283198-55283220 CTAGGAGGACAGTGGCCAGAGGG + Intronic
1150157507 17:62866428-62866450 CCAAGTGGGCAGGGGCCAAATGG + Intergenic
1150835490 17:68560054-68560076 CCATGAGGGCAGAGCCCTCATGG + Intronic
1151294100 17:73171106-73171128 CCCCAAGGGCAGAGGCTAGAAGG - Intergenic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151766776 17:76137034-76137056 CCATGAGAGCCGAGGCCTGGAGG - Exonic
1151839850 17:76609998-76610020 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1152408877 17:80112119-80112141 CTGTGAGGGCAGAGCCCAGTGGG - Intergenic
1152705434 17:81841223-81841245 GGATGTGGGCAGAGGCCCGAGGG - Intergenic
1153235704 18:2984938-2984960 CCAGCAGGGCAGAGGTCAGCGGG + Intronic
1156252025 18:35360394-35360416 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1156452986 18:37277116-37277138 CCAGCAGGGCAGAGGGCAGGAGG - Intronic
1156915716 18:42463169-42463191 GGATGAGGGGAGAGGTCAGATGG - Intergenic
1156924149 18:42556570-42556592 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1157288467 18:46393410-46393432 GCCTGAGGGCAGACGCCAGAAGG + Intronic
1157725050 18:49957887-49957909 CAAAGAGGGGAGGGGCCAGAGGG - Intronic
1157749755 18:50167845-50167867 CCGTGGGGCCAGAGGGCAGATGG - Intronic
1160125646 18:76169277-76169299 CCATGTGGTCAGGGGCCAGGAGG - Intergenic
1160378101 18:78429375-78429397 GGAGGAGGGCAGAGGCCAGTGGG - Intergenic
1160605756 18:80048542-80048564 CCATGAGGACAGAGACCAGAAGG + Intronic
1160824229 19:1071901-1071923 CCGGGAGGACAGAGGCCAGCGGG - Intronic
1160963743 19:1736522-1736544 CCATGTGGACAGAGTCGAGAGGG + Intergenic
1161105495 19:2441764-2441786 CCCTGGGGGCAGAGACCTGAAGG + Intronic
1161353831 19:3808475-3808497 CCAGGAGCTCAGAGGACAGAGGG - Intronic
1161661629 19:5550138-5550160 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1162014861 19:7839940-7839962 CCTGGAGAGCAGAGGCCAGTTGG + Intronic
1162341063 19:10091827-10091849 CCATGGGGGCAGAGGCCATGGGG - Intronic
1163047072 19:14650991-14651013 CCATGAGGGGAGAGCCCAGTGGG + Intronic
1163500086 19:17671122-17671144 CCATGAGGTCATAGCCCAGAGGG + Intronic
1164117545 19:22236915-22236937 CCATGATGGCAGGGGCCAAGTGG - Intergenic
1164511072 19:28897658-28897680 CCATGAGGGAAGAGCCTACATGG + Intergenic
1165109289 19:33492299-33492321 CCTTGAGGGCAGACGCCCGGTGG + Intronic
1165268494 19:34682176-34682198 TCATGAGGGCAGAGTCCTCAAGG + Intronic
1165274708 19:34738387-34738409 TCATGAGGGCAGAGCCCTCAAGG + Intronic
1165449661 19:35874672-35874694 CCGTGGGGGCAGAGAGCAGAGGG + Intronic
1165497094 19:36159445-36159467 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1165503001 19:36205029-36205051 CCATGAGGGCAAGGACCAGTGGG + Intronic
1165510400 19:36263526-36263548 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1165935234 19:39384972-39384994 CCAGGAGGGCGGGGGCAAGAAGG - Intronic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1166499030 19:43327546-43327568 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1167094848 19:47369699-47369721 ACATCTGGGCAGAGGCCTGAAGG + Intronic
1167099323 19:47394329-47394351 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1167166408 19:47802752-47802774 CCCTGGGTGCAGAGCCCAGAAGG - Exonic
1167537043 19:50060317-50060339 TGATGAGGGCAGAGGCCTGCCGG + Intergenic
1168051496 19:53832930-53832952 CGAGGAGGGGAGAGGTCAGACGG - Intergenic
1168260018 19:55188059-55188081 CCAGGTGGGGAGAGGACAGAGGG - Exonic
1168277424 19:55285348-55285370 CCATAGGGGCAGAGGCTGGAGGG + Intronic
1202706525 1_KI270713v1_random:28508-28530 CCATGAGGACAGACAGCAGAAGG - Intergenic
925334982 2:3090347-3090369 CCATGAAGGCAGTGCTCAGAGGG + Intergenic
925366203 2:3313854-3313876 CGAGGAAGGCAGAGGCAAGAGGG + Intronic
925457067 2:4024788-4024810 GCATGGGGGCAGAGGGCAGTGGG - Intergenic
925745566 2:7040661-7040683 GACTGAGGCCAGAGGCCAGACGG - Exonic
926464178 2:13168032-13168054 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
927040392 2:19224443-19224465 CTGTGTGGGCAGAGGCCAGCTGG - Intergenic
927057064 2:19375125-19375147 CCATGATGGCAGAGCCCTCATGG + Intergenic
927104694 2:19813034-19813056 CCTTGTGGCCAGAGGCCTGATGG - Intergenic
927517259 2:23679764-23679786 GGAGGAGGGCAGAGGGCAGAGGG + Intronic
927680424 2:25135529-25135551 CCATGAGGGCGGTGGAGAGAAGG - Exonic
927752885 2:25685763-25685785 TCATGAGGCCAGAGGCTAGATGG + Intergenic
927893076 2:26764491-26764513 CCAGGAGGGCAGGGCCAAGAAGG - Intronic
928742923 2:34376866-34376888 TCCTGAGGGCAGAGGCCTCATGG + Intergenic
928770085 2:34695491-34695513 TGATGAGGGGAGAGGTCAGATGG - Intergenic
928779769 2:34804936-34804958 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
928857071 2:35814716-35814738 CTAGGAGGGGAGAGGTCAGATGG - Intergenic
929004925 2:37385051-37385073 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929593678 2:43162506-43162528 CCTTGGGGGCAGTGGCCAGAGGG + Intergenic
930034355 2:47076258-47076280 GCAAGAGGGAAGAGTCCAGACGG - Intronic
930487460 2:52026193-52026215 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
930955008 2:57194635-57194657 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
931441144 2:62291508-62291530 TCATGTGGCCAGAGGTCAGAAGG + Intergenic
931625683 2:64254199-64254221 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
931948166 2:67333244-67333266 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
932295764 2:70622286-70622308 CGAGGAGGGGAGAGGTCAGATGG - Intronic
932343739 2:70982462-70982484 GGATGAGGGGAGTGGCCAGAGGG - Intronic
932358907 2:71089087-71089109 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
932469674 2:71945598-71945620 CCATGAGGACAGAGAGCAGGAGG + Intergenic
933079187 2:77966775-77966797 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
933099497 2:78234769-78234791 ACATGTGGGAAGAGGACAGAAGG + Intergenic
933329609 2:80878508-80878530 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
933811846 2:86037442-86037464 CCATAAGGTGAGAGGGCAGAGGG + Intronic
933839668 2:86276281-86276303 CCATGAGGGAAGGGGCCTGGTGG - Intronic
934122549 2:88854149-88854171 CCAAGGAGGCAGAGACCAGAGGG - Intergenic
934706419 2:96484736-96484758 TCATGAGGGCAGAGGCTTCATGG - Intergenic
934710940 2:96513578-96513600 CCATGAAGGCACAAACCAGAAGG - Intergenic
934885609 2:98021627-98021649 CGGTGAGTGCAGTGGCCAGAAGG - Intergenic
935123710 2:100203807-100203829 CTCAGAGGGCAGAGGCAAGACGG - Intergenic
935796606 2:106647846-106647868 CTGTGAGGCCACAGGCCAGAGGG + Intergenic
936341228 2:111634125-111634147 CCATGAGGGATGAGGTCAGATGG + Intergenic
936548310 2:113412046-113412068 CCAGCAGGGCAGAGGCCAGCAGG + Intergenic
937116139 2:119406358-119406380 CCATGAGGACAGAGCCCAAGCGG + Intergenic
937387926 2:121453908-121453930 TTCTGAGGGCAGAGGGCAGAGGG + Intronic
937759878 2:125588477-125588499 CTATGAGGGTAGAAGCAAGATGG + Intergenic
939307315 2:140427784-140427806 CGAGGAGGGGAGAGGACAGATGG - Intronic
939651082 2:144762868-144762890 CCATGAGGGCAGAACCCTCAGGG - Intergenic
940682772 2:156807177-156807199 TCATGAGGGCAGAGCCCTTATGG - Intergenic
941340313 2:164297520-164297542 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
942096994 2:172543378-172543400 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
942229753 2:173849358-173849380 CCAGGAGCACAGAGCCCAGAGGG - Intergenic
942714324 2:178874090-178874112 CTAAGAAGGCAGAGGCCAGCTGG - Intronic
942730382 2:179055819-179055841 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
943421671 2:187674516-187674538 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
943616354 2:190096912-190096934 CCATGAGGGCAGAGCCCTTGTGG + Intronic
943675812 2:190715599-190715621 CCAGAAAGGCAGAGGCCAGGGGG + Intergenic
943806557 2:192132087-192132109 CGAGGAGGGGAGAGGTCAGATGG - Intronic
943835057 2:192507690-192507712 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
944167069 2:196734431-196734453 TCATGAGGGCAGAGCCCCAAAGG - Intronic
945153195 2:206810899-206810921 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
945361554 2:208900887-208900909 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
946095072 2:217267515-217267537 CCATGAGGCTAGAAGCAAGATGG - Intergenic
946167154 2:217871318-217871340 CCTTGAAGTCACAGGCCAGAAGG + Intronic
946215124 2:218178074-218178096 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
946221687 2:218232946-218232968 TCATGAGGGCAGAGCCCTCATGG + Intronic
947679615 2:232018324-232018346 CCATGATGTCACAGGCCAGAAGG - Intronic
947932209 2:233973439-233973461 CCATGAGGACAGGGATCAGAGGG - Intronic
948027673 2:234790940-234790962 CCATGTGGGGTCAGGCCAGATGG - Intergenic
948128845 2:235585325-235585347 CTACCACGGCAGAGGCCAGAGGG - Intronic
948176245 2:235945844-235945866 CCATCATGGCAGAAGGCAGAGGG + Intronic
948193632 2:236078971-236078993 CCATGAGGGATGAGGCTAAAGGG - Intronic
948353967 2:237362406-237362428 ACATAAGGTCAGGGGCCAGATGG - Intronic
948381645 2:237554370-237554392 CCAGTGGGGCAGAGGACAGAGGG + Exonic
948429601 2:237911359-237911381 CCAGGAGGGCAGGGGCCCGATGG - Intronic
948937617 2:241177873-241177895 CCAGCAGGGCAGTGGGCAGATGG - Intronic
1169513057 20:6285732-6285754 CCCTAAGGGCAGAGGGCATATGG + Intergenic
1170068954 20:12344321-12344343 CCAAGAGGGGAGAGGTCAGACGG + Intergenic
1170106142 20:12755537-12755559 CCAAGAGGGGAGAGGTCAGATGG - Intergenic
1171298872 20:24042049-24042071 CCAAGAGGGCAAAGGGCAAAGGG - Intergenic
1171336049 20:24386506-24386528 TCATGAGGGCAGAGTCCTCATGG - Intergenic
1171403117 20:24892180-24892202 CCAGGAGGGCAAAGGCCAGCGGG + Intergenic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1172212926 20:33213655-33213677 CCATGAGGGCAAAGGCCCTCAGG - Intergenic
1172772463 20:37389546-37389568 CCAGGTGGGCAGTGGCCAGGAGG - Intronic
1173101819 20:40095009-40095031 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1173118780 20:40270725-40270747 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1173362188 20:42354850-42354872 CCTTGAGGAGAGAGGTCAGACGG + Intronic
1173701472 20:45075657-45075679 ACATGAGGGCAGAGGACACCGGG + Exonic
1173703617 20:45094374-45094396 TCATGAGGGCAGAAGAAAGATGG + Exonic
1173749764 20:45468179-45468201 CAATGAGGGCAGGAGCCAGGTGG - Intergenic
1173927466 20:46791682-46791704 CCATGAGGGGATAGGACACAGGG - Intergenic
1174181421 20:48677252-48677274 CCAGGAGGGCGGAGGCAGGATGG + Intronic
1174418746 20:50385468-50385490 CCATGAGGGCATGTGCCATATGG - Intergenic
1175332842 20:58176845-58176867 TCTTGAGGGCAGAGGCCAAGAGG + Intergenic
1175661550 20:60817211-60817233 CCATGAGGGCAGGATCCTGATGG + Intergenic
1175908574 20:62393862-62393884 CCACCAGCACAGAGGCCAGAGGG + Intronic
1176239261 20:64068403-64068425 CCTTGGGGGAAGAGGCCAGGGGG - Intronic
1176705615 21:10118532-10118554 CCATGAGGGCAGAGGGCGAGAGG + Intergenic
1177003567 21:15643165-15643187 CCATGGAGGCAGAGGTCGGAGGG - Intergenic
1177119473 21:17123119-17123141 CGATGAGGGGAGAGGTCAGATGG - Intergenic
1177411782 21:20738950-20738972 CCATCAGGGCAGAAGGCAAAAGG - Intergenic
1177677171 21:24315911-24315933 CTCTGAGGGCAGAGGACACAAGG + Intergenic
1178133058 21:29595132-29595154 CCAGGAGGGAAGAGGCATGAAGG + Intronic
1178707316 21:34886761-34886783 CCGCGAGGGCAGCGGCCAGGCGG - Intronic
1178741031 21:35201520-35201542 CCATGCGTGCAGAGGCCTGGAGG - Intronic
1179178589 21:39026498-39026520 ACAGGAGGAAAGAGGCCAGAGGG + Intergenic
1179511135 21:41874548-41874570 ACAAAAGGCCAGAGGCCAGAGGG + Intronic
1180979588 22:19872335-19872357 GCAGGTGGGCAGAGGCCAGCAGG + Intergenic
1181486782 22:23236596-23236618 TCATGTGGGCAGAGCCCAGTGGG + Intronic
1182848450 22:33451034-33451056 CGAAGAGGGCAGTGGCAAGAGGG - Intronic
1184094146 22:42307470-42307492 CCGTGAGGGCAGAGATCAGAGGG - Intronic
1184175100 22:42784582-42784604 ACAGGAGGGCAGTGGGCAGATGG - Intergenic
1184468811 22:44684074-44684096 CCAGGAGGGCCCGGGCCAGAGGG + Intronic
1184552746 22:45213273-45213295 GGCTGAGGGCAGAGGGCAGAGGG - Intronic
1184585331 22:45444106-45444128 TCAGGTGGGCAGAGGCCTGATGG + Intergenic
1185339292 22:50284393-50284415 CCAGGGAGGCAGAGGGCAGAGGG + Intronic
950452445 3:13072946-13072968 GCCTGAAGCCAGAGGCCAGAGGG - Intronic
951316412 3:21193268-21193290 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
952991156 3:38832084-38832106 CTATGAGGGCAGAGCCCTCAGGG + Intergenic
953355657 3:42254414-42254436 CCATGTGGCCAGCAGCCAGAGGG - Intergenic
953391182 3:42534764-42534786 CCAGGAGGGCTGGGGGCAGAAGG + Intronic
953433097 3:42855640-42855662 TCAGGAGGGCAAAGGCCTGATGG + Intronic
953628094 3:44587462-44587484 ACATGAGGCCACAGGCCAGTAGG - Intronic
953825795 3:46250336-46250358 CAAGGAGGGGAGAGGTCAGATGG + Intronic
954502503 3:51031771-51031793 CCATGAGGGCAGAGCCCTCGTGG - Intronic
954655980 3:52194608-52194630 CCTTCAGGGCAGAGGCCTGCAGG - Intergenic
956637305 3:71379071-71379093 TAATGAGGGCAGAGGGAAGAAGG - Intronic
956709125 3:72024628-72024650 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
957675345 3:83357187-83357209 GGATGAGGGGAGAGGTCAGATGG + Intergenic
958036370 3:88174325-88174347 CTATGATGGGAGAGGCCAAATGG + Intergenic
958181911 3:90071725-90071747 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
958750910 3:98192598-98192620 GGATGAGGGGAGAGGTCAGATGG - Intronic
960137555 3:114121351-114121373 CCATGAGGGCAAAGCCCTCATGG - Intergenic
960142724 3:114166419-114166441 TCATGAGGGCAGAGTCCTCAAGG - Intronic
960282970 3:115797547-115797569 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
960556614 3:119036961-119036983 GCATGAGGGCAGATGGTAGATGG + Intronic
960625381 3:119677069-119677091 GGAAGAGGGCAGAGGGCAGAAGG + Intronic
960987479 3:123290318-123290340 CCAGGAGGGCCGGGGCCAGGGGG - Intronic
961008619 3:123421666-123421688 GCATGGGGGCACAGGACAGATGG + Intronic
961164857 3:124756596-124756618 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
961240070 3:125403005-125403027 CCATGAAGACAGAGGCCTCATGG + Intergenic
961818749 3:129564573-129564595 CTATGGTGGCAGAGGCTAGAGGG - Intronic
961893805 3:130151210-130151232 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
961987807 3:131156528-131156550 GCATGAGGGAAGGGGCAAGATGG - Intronic
962660537 3:137597113-137597135 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
963058526 3:141206606-141206628 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
963793301 3:149605991-149606013 TCATGGGGGCAGAGCCCACATGG + Intronic
964359344 3:155878108-155878130 GCATGAGGGCAGAGCCCACACGG - Intronic
964984963 3:162726591-162726613 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
965070235 3:163909208-163909230 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
965286825 3:166828147-166828169 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
965389222 3:168084217-168084239 CAATGATGGCAGAGGGCAAAGGG - Intronic
965546857 3:169925082-169925104 CCATAAAGGCAGTGGCCAGAAGG + Exonic
966105178 3:176325667-176325689 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
966232939 3:177669890-177669912 CGAGGAGGGGAGAGGTCAGACGG + Intergenic
966279206 3:178209171-178209193 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
966730421 3:183146437-183146459 CCATTAGGGCAGAAGTCACAGGG + Intronic
966821796 3:183930637-183930659 CAATGGAGGCAGAGGCCAGAGGG + Intronic
967212258 3:187179571-187179593 CGAGGAGGGGAGAGGTCAGATGG + Intronic
967643931 3:191899451-191899473 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
968052615 3:195665708-195665730 CCATGGGGTCACAGCCCAGATGG - Intergenic
968103196 3:195982646-195982668 CCATGGGGTCACAGCCCAGATGG + Intergenic
968110860 3:196045455-196045477 CCATCATGGCAGAAGGCAGAGGG + Intronic
968301504 3:197620224-197620246 CCATGGGGTCACAGCCCAGATGG + Intergenic
968453050 4:684069-684091 CCCAGAAGGCAGAGGGCAGAGGG + Intronic
969146348 4:5127351-5127373 TCTTGAGTGCAGAGGGCAGAGGG + Intronic
969215421 4:5718561-5718583 GCATGAGAGCAGAGACAAGAAGG + Intronic
969401058 4:6955823-6955845 CCCTGAAGGCAGAGGACAGCTGG - Intronic
969748964 4:9095898-9095920 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
970029331 4:11657802-11657824 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
970256515 4:14174574-14174596 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
970528887 4:16962152-16962174 CCATGATGGCAGGAGACAGAGGG + Intergenic
971161209 4:24135974-24135996 CCAGGAGGGGAGAGAGCAGAGGG + Intergenic
971180463 4:24324876-24324898 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
972360301 4:38320282-38320304 ACATAGGGGCAGAGGCCAGGAGG - Intergenic
973267501 4:48225820-48225842 CCATGAGAGAAGAAACCAGAAGG + Intronic
973589223 4:52423920-52423942 CCATGAGGGAAGAGACCATGGGG + Intergenic
974362936 4:60906445-60906467 CCTGGAGGGCTGAGGCCAGTAGG - Intergenic
974428489 4:61768336-61768358 CGAGGAGGGGAGAGGTCAGATGG + Intronic
974687425 4:65247987-65248009 CTATGAGGGCAGAGCCCTCATGG - Intergenic
975611351 4:76206738-76206760 CCCGCAGGGCTGAGGCCAGAAGG + Intronic
975954551 4:79821994-79822016 CCATGAGGGTAGAGCCCTCATGG + Intergenic
976431692 4:84969078-84969100 CCCTTTGTGCAGAGGCCAGATGG + Intergenic
976768219 4:88620860-88620882 CCATGGGAGCAGAGACCTGAAGG - Intronic
977217246 4:94297261-94297283 CTAGGAGGGGAGAGGTCAGATGG + Intergenic
977225434 4:94387516-94387538 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
977354984 4:95934084-95934106 GCAGGAGGGCAGAGGGCAAAAGG + Intergenic
977748937 4:100585135-100585157 CTATGAGGGCAGAGACCTCATGG + Intronic
978001210 4:103557810-103557832 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
980112022 4:128644893-128644915 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
980284858 4:130768997-130769019 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
980457420 4:133063446-133063468 TCATGAGGGCAGAGTCCTTATGG + Intergenic
980611868 4:135171339-135171361 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
981407491 4:144387845-144387867 CCATGAGGGCAGAGCCCTTATGG + Intergenic
981525110 4:145700771-145700793 CGAGGAGGGGAGAGGTCAGATGG - Intronic
981867520 4:149441869-149441891 CCATGAGGGCACAGCCCTCATGG + Intergenic
982180570 4:152745400-152745422 CGAGGAGGGGAGAGGTCAGATGG + Intronic
982274265 4:153623171-153623193 TCAGGAGTGCAGAGGACAGATGG + Intronic
982414289 4:155112510-155112532 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
982535351 4:156601946-156601968 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
982563973 4:156965908-156965930 CGATCAGGACAGAGGCCAGCAGG + Intronic
982973657 4:162023835-162023857 CTCTGAAGCCAGAGGCCAGAAGG - Intronic
983055394 4:163094753-163094775 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
983265466 4:165503453-165503475 CCATGATGTCAGGGGCCACAAGG + Intergenic
983707586 4:170679128-170679150 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
984393705 4:179168937-179168959 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
984706001 4:182847698-182847720 CCAGAAGGGCAGAGAGCAGAGGG + Intergenic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
985231155 4:187819719-187819741 TCATGAGGGCAGAGGCCTCATGG - Intergenic
985825996 5:2192059-2192081 TCAGCAGGGCAGAGGCCAGGTGG - Intergenic
986193446 5:5517220-5517242 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
986292470 5:6411241-6411263 CCATGAAGGCAGATGACAGACGG + Intergenic
986388788 5:7265249-7265271 CGAGGAGGGAAGAGGTCAGATGG - Intergenic
986504068 5:8430535-8430557 CCATGAGTGCTGGGGCCACAGGG - Intergenic
986905686 5:12491500-12491522 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
987080213 5:14419196-14419218 ATCTGAGGGCAGAGGGCAGAGGG + Intronic
987249038 5:16080068-16080090 AAATGAGGGTAGAAGCCAGAAGG - Intronic
987608670 5:20173153-20173175 CCATGAGGGCAGCAGCCATGGGG - Intronic
988169421 5:27634623-27634645 CCAGGATGGCAGGGGCCAAATGG - Intergenic
989196779 5:38724108-38724130 TCATGAGGGCAGAGCCCTCAGGG - Intergenic
990055578 5:51572737-51572759 CCATGAGAGTAGAGGCCTCATGG - Intergenic
990100458 5:52178658-52178680 ACATGAGGACAGAGCCCACATGG - Intergenic
994295051 5:98080701-98080723 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
994516242 5:100775759-100775781 CATTGTGGGTAGAGGCCAGAGGG + Intergenic
994532632 5:100988301-100988323 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
994764747 5:103901874-103901896 TAATGAGGGCAGAGGCCTCATGG - Intergenic
995779591 5:115761513-115761535 TCATGAGGGCAGAGCCCTCATGG + Intergenic
996509812 5:124305423-124305445 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
996590416 5:125140550-125140572 CCATGAGGACAGAGGCCTCATGG + Intergenic
997423709 5:133788493-133788515 CCATCAGGGCCGTGGCCAGTTGG - Intergenic
997750910 5:136344962-136344984 CCATGAGGGCAGAGACTACAGGG + Intronic
997904935 5:137807192-137807214 TCATGAGGGCAGAGCCCTCATGG + Intergenic
998187105 5:139988875-139988897 GTATGAGGGCAGAGGCCATATGG + Intronic
998195991 5:140071966-140071988 GTATGACGGCAGAGGCCATAAGG - Intergenic
998996491 5:147873020-147873042 CGAGGAGGGGAGAGGTCAGATGG + Intronic
999096123 5:148979449-148979471 ACAAGAGGGCAGAAGCCAGATGG - Intronic
999277106 5:150338751-150338773 TCATGATGGCGGTGGCCAGAAGG + Intronic
999280209 5:150360311-150360333 CCTTTGGAGCAGAGGCCAGAGGG - Intronic
999282545 5:150374916-150374938 GGATGAGGGGAGAGCCCAGAGGG - Intronic
999737061 5:154520986-154521008 ACATCAGGGAAGAGGCTAGAAGG + Intergenic
1001036440 5:168300085-168300107 CCATGCTGGGAGAGGCAAGACGG - Intronic
1001178222 5:169493034-169493056 TCATGAAGACAGAGGGCAGAAGG + Intergenic
1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG + Intergenic
1001655768 5:173348361-173348383 CTATGAGGTCAGAGCCCTGAGGG - Intergenic
1001858290 5:175031783-175031805 CCATGAGGGAGAAGGCTAGAGGG - Intergenic
1002589861 5:180283035-180283057 CCCTCAGGACTGAGGCCAGACGG - Intronic
1002639634 5:180624674-180624696 CCATGTGGGCAGATCCCAGGTGG - Intronic
1002883964 6:1277404-1277426 TCATGAGGGCAGAGACCTTATGG - Intergenic
1003326621 6:5096805-5096827 CCAAACTGGCAGAGGCCAGAGGG - Intergenic
1003378072 6:5597407-5597429 CCAAGAGCTCATAGGCCAGAGGG - Intronic
1004959763 6:20773901-20773923 TGATGGGGGCAGAGGGCAGAGGG - Intronic
1005650524 6:27880768-27880790 CCATGAGGTTAGAAGCAAGATGG + Intergenic
1005709259 6:28487753-28487775 CCATGAGGCTAGAAGCAAGATGG + Intergenic
1005940839 6:30558160-30558182 CCATGGGGGGAGGGCCCAGAAGG - Exonic
1006801952 6:36765304-36765326 GCAGGAGGGCAGGGGCGAGAAGG - Intronic
1006814849 6:36843163-36843185 TCATGAGGGCAGAGGTGAGACGG + Intergenic
1007511350 6:42376477-42376499 CCAGAAGGGCAGAGGGGAGAGGG + Intronic
1007843901 6:44738488-44738510 CCAGGAGGGCTGAGAGCAGAGGG + Intergenic
1008389151 6:50929365-50929387 ACATTTGAGCAGAGGCCAGAAGG + Intergenic
1008420572 6:51294463-51294485 TCATGAGGGCAGAGGTCTCATGG + Intergenic
1008746350 6:54674291-54674313 CCATGAGGGTGGAGGCCTCATGG - Intergenic
1008933259 6:56962031-56962053 TCATGAGGGCAGAGCCCTCATGG - Intronic
1009359267 6:62793142-62793164 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1010012858 6:71069290-71069312 CCATCAGGGCAGAGCCCTCATGG + Intergenic
1010564683 6:77395697-77395719 CAATGAGGGCTGAGACCACAGGG - Intergenic
1010827008 6:80486485-80486507 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1011038372 6:83002349-83002371 CCATGAGGGCAGAGCCATCATGG - Intronic
1012066635 6:94557993-94558015 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1012447774 6:99324029-99324051 CCATGGGGGCACAGGGCAGGAGG + Intronic
1012689485 6:102294588-102294610 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1013891611 6:115033547-115033569 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1014360251 6:120466314-120466336 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1014454963 6:121624486-121624508 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1014718801 6:124893699-124893721 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1014836955 6:126170697-126170719 CCATGAGGGCACAGATCAGCGGG - Intergenic
1014891453 6:126850415-126850437 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1015182819 6:130379069-130379091 CCATGAGGGCAGAGGCCTCGTGG + Intronic
1015266641 6:131297120-131297142 CGAGGAGGGAAGAGGTCAGATGG - Intergenic
1015269567 6:131325082-131325104 CGAGGAGGGTAGAGGTCAGATGG - Intergenic
1015271280 6:131340537-131340559 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1016363761 6:143294113-143294135 GTATGAGGCCAGAGTCCAGAAGG - Intronic
1016795817 6:148116080-148116102 CCACGAGTGCTGATGCCAGAGGG + Intergenic
1016934777 6:149441462-149441484 CCCTGATGGCAGAGGCCATGCGG + Intergenic
1016991711 6:149934541-149934563 CCCTGAGGGCAAAGAGCAGAGGG + Intergenic
1016998402 6:149977210-149977232 CGATGTGGGCAGAGCCCAGGTGG + Intergenic
1017004050 6:150016865-150016887 CCCTGAGGGCAAAGAGCAGAGGG - Intergenic
1017389401 6:153923148-153923170 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1017779425 6:157704731-157704753 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1018276491 6:162137770-162137792 TCATGAGGGCAGAGCCCCGATGG + Intronic
1018520052 6:164639121-164639143 CCTTGAGGGCAGAGGGTAGGAGG - Intergenic
1018672987 6:166194922-166194944 TCATGGGGACAGAGGCCAGGAGG + Intergenic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019867194 7:3722835-3722857 CCAGGAGGGGAGTGGTCAGATGG - Intronic
1020001244 7:4757166-4757188 CCTTGAGGACAGAGGCCCGAAGG - Exonic
1020324033 7:6960742-6960764 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1020541222 7:9462578-9462600 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1021018973 7:15572759-15572781 TCATGAGGGTGGAGGCCACATGG - Intergenic
1021044233 7:15902881-15902903 CGATGAGGGAAAAGGCCTGAGGG + Intergenic
1021608123 7:22429989-22430011 CCTTGAGGGCAGAGGGCATGAGG + Intronic
1021771431 7:24005757-24005779 CCATGAGGGCAGAGACCTCCTGG + Intergenic
1021977989 7:26028232-26028254 CTAGGAGGGGAGAGGTCAGATGG + Intergenic
1022369785 7:29759619-29759641 CCATGAGGGCAGAGCCCTCATGG - Intergenic
1022477920 7:30723805-30723827 CAATGAGGGCAGGGGCTGGAGGG + Intronic
1022631759 7:32092061-32092083 CTAAGAGGGCAGAAGCCTGAGGG + Intronic
1022710137 7:32841950-32841972 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1022783450 7:33610591-33610613 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1023677597 7:42646820-42646842 TCATGAGGGCAGAGCCCTCATGG - Intergenic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1023991935 7:45133696-45133718 TGATGAGGGCAGAGGGCTGAGGG - Intergenic
1024724601 7:52178122-52178144 TCATGAGAGCAGAGCCCTGATGG + Intergenic
1025161454 7:56664838-56664860 CCAGGAGGGCAGAGCCCAGCAGG - Intergenic
1025252252 7:57359518-57359540 CCATGAGGGCATGCGCCATATGG + Intergenic
1025777668 7:64573364-64573386 CCATTAGGGCCAAGGCCAAATGG + Intergenic
1026221530 7:68402139-68402161 CCATGCAGGCAGGGTCCAGAGGG + Intergenic
1026385649 7:69845113-69845135 TCATGAGGTCAGAAGCCTGAAGG - Intronic
1026493203 7:70880968-70880990 CTATGAAGGAAGAGGACAGAAGG + Intergenic
1026858263 7:73769069-73769091 GCATGGGGGCAGCGGCCCGATGG + Exonic
1029177510 7:98675279-98675301 CCAGGAGGTCACAGGACAGATGG - Intergenic
1029941463 7:104484748-104484770 CCATGAGGGGGGAAGGCAGAAGG + Intronic
1030445875 7:109646198-109646220 GGATGAGGGGAGAGGTCAGATGG + Intergenic
1030751597 7:113237626-113237648 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1030986472 7:116247098-116247120 CCATGATGGCAGAGAGCACATGG + Intronic
1031004577 7:116457146-116457168 CGAGGAGGGGAGAGGTCAGATGG - Intronic
1031173918 7:118325066-118325088 CCATGCCAGCAGAGGGCAGAGGG + Intergenic
1031476000 7:122222538-122222560 CAAAGAGGCCAGAGGCCACAAGG + Intergenic
1031790478 7:126095382-126095404 TCATGAGGGCAGATGCCTCATGG - Intergenic
1032077808 7:128844328-128844350 CATAGGGGGCAGAGGCCAGAGGG + Intronic
1032171445 7:129587889-129587911 ACACGAGGCCAGAGGCAAGAAGG - Intergenic
1032386933 7:131531654-131531676 CCATGAGGGCAGAGGTTGGCGGG - Intronic
1033272550 7:139945798-139945820 GACTGAGGGCTGAGGCCAGAGGG + Intronic
1034084924 7:148314122-148314144 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1034382903 7:150714506-150714528 CAATCATGGCAGAAGCCAGAGGG - Intergenic
1034491446 7:151395174-151395196 CCATGAGGACGGAGCCCAGGAGG + Intronic
1034531337 7:151697932-151697954 CCATGGGTGCACAGGCCAGTGGG + Intronic
1034874844 7:154716143-154716165 CCATGACGGCTGAGGGGAGATGG - Intronic
1035264347 7:157682817-157682839 AGATGAGGCCAGAGGCCAGGAGG + Exonic
1035369664 7:158371999-158372021 CCAGGAGGGCTGATGGCAGAGGG - Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1036071017 8:5440711-5440733 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1036224211 8:6944434-6944456 ACATCAGAGCAGAGGCCAGGAGG + Intergenic
1036372039 8:8170243-8170265 CCAGGATGGGAGAGGTCAGATGG - Intergenic
1036472431 8:9063520-9063542 CAAGGAGGGGAGAGGTCAGATGG + Intronic
1036639394 8:10572909-10572931 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1036878861 8:12495398-12495420 CCAGGATGGGAGAGGTCAGATGG + Intergenic
1037393234 8:18416427-18416449 CCCAGAGGGCAGAGGCTAGGGGG - Intergenic
1037805407 8:22055797-22055819 GCTTGAGGGAAGAGGCCAGGAGG - Intronic
1037858007 8:22385345-22385367 CCAGGAGGGCAGAGACTGGAGGG - Intronic
1038841421 8:31187986-31188008 CCATGAGGGCAGAGTCCTCATGG + Intergenic
1039305199 8:36254595-36254617 CCGTGAGGCCAGAAGCAAGATGG - Intergenic
1039546510 8:38414672-38414694 CCATGAGGGCACAGGTGGGAAGG + Intronic
1040379235 8:46856288-46856310 CCATGTGGGCAGAGCCAAGCAGG - Intergenic
1040598930 8:48865497-48865519 CCTGGAAGGCAGAGGCCTGAGGG + Intergenic
1042213260 8:66402893-66402915 CCAGGAGGGGAGAGGGCAAATGG + Intergenic
1042474696 8:69233893-69233915 CCATGAGGGCAGAGACCTCAGGG - Intergenic
1042775461 8:72425829-72425851 TCATGAGGGCAGAGGTCTCATGG + Intergenic
1043353764 8:79390153-79390175 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1043401108 8:79885129-79885151 CCCTGAGGGCAGTGGGCTGAGGG + Intergenic
1043558149 8:81458127-81458149 TCAAGTGGGCAGAGGACAGAGGG + Intergenic
1043598745 8:81915046-81915068 GGATGAGGGGAGAGGTCAGATGG - Intergenic
1043978458 8:86609783-86609805 CCATGAGCTGAGAGGCAAGATGG - Intronic
1044656248 8:94551578-94551600 CCTTGAGAGCATAGGGCAGATGG - Intronic
1044727333 8:95204150-95204172 CCATGAGGCCAGATGCCTGCTGG + Intergenic
1044760391 8:95511497-95511519 TCATGAGGGCAGAGGCCTCGTGG - Intergenic
1044921894 8:97176743-97176765 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1044925067 8:97202587-97202609 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1045115949 8:98979855-98979877 CCATGAGGGCAGAACTCATATGG + Intergenic
1045644692 8:104287606-104287628 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1045683158 8:104683926-104683948 CCATGAGAGCAGAGTCCTTATGG + Intronic
1045718831 8:105081573-105081595 ACTTGAGGGAAGAGGCTAGAAGG + Intronic
1046195350 8:110856706-110856728 ACATGAGGGCAGAGGGTGGAAGG + Intergenic
1046386433 8:113513561-113513583 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1047829632 8:128615956-128615978 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1048097521 8:131311835-131311857 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1048143679 8:131820818-131820840 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1048325508 8:133436134-133436156 CAAGGTGGGCAGAGGACAGAAGG + Intergenic
1048385996 8:133913110-133913132 CCTGGAGGGCAGAGGCCAGGTGG - Intergenic
1048935253 8:139349870-139349892 CCCTGGGGCCAGAAGCCAGAGGG - Intergenic
1049078876 8:140425173-140425195 CCCCAAGAGCAGAGGCCAGAAGG + Intronic
1049178309 8:141207115-141207137 CCAGGAAGGCAGAGGGCAGGAGG + Intergenic
1049191360 8:141289665-141289687 CTAAGAGGTCAGGGGCCAGAGGG + Intronic
1049277575 8:141727577-141727599 CCAGGAGGGCTGAGTTCAGAGGG - Intergenic
1049939512 9:531777-531799 CAGTGAGGACAGACGCCAGAAGG - Intronic
1050123779 9:2335404-2335426 AAATCAGGCCAGAGGCCAGATGG - Intergenic
1050258204 9:3815245-3815267 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1050769282 9:9176611-9176633 TCATGAGGGCAGAGGCCTCATGG - Intronic
1051193303 9:14536694-14536716 CCATGAAGGCAGGGACAAGAAGG + Intergenic
1051602070 9:18885296-18885318 CCATGAGGACAGAGCCCTCATGG + Intronic
1051846888 9:21462028-21462050 ATATGAGGGTAGAGACCAGAAGG - Intergenic
1051849382 9:21489749-21489771 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1052162992 9:25289335-25289357 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1053196900 9:36126562-36126584 CCATGAAGGTAGATGCCAGAAGG + Intergenic
1053459665 9:38258522-38258544 TCATGAGGGCAGAGCCCTCACGG + Intergenic
1053727253 9:41016741-41016763 CCAGCAGGGCAGAGGCCAGCAGG - Intergenic
1054701263 9:68415371-68415393 CCAGCAGGGCAGAGGCCAGCAGG + Intronic
1055019157 9:71650321-71650343 TCATGAGGGCAGAGCCCTGATGG - Intergenic
1055347813 9:75355855-75355877 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1056044831 9:82704758-82704780 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1056651423 9:88467606-88467628 ACCTGAGGGCAGAGGCGTGAAGG + Intronic
1057149177 9:92781059-92781081 CCATGAGTGCAGACACCACATGG - Intergenic
1057771156 9:97969276-97969298 CCAGAGGGGCAGAGGACAGATGG - Intergenic
1057988630 9:99744226-99744248 TCATGAGGGGAGAAGACAGAGGG - Intergenic
1058612310 9:106789833-106789855 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1058859371 9:109099848-109099870 CCATGAGGGCTGAGCCCTGATGG - Intronic
1058941497 9:109816798-109816820 CCATGAGGGCAGAGGAGTCATGG + Intronic
1059447850 9:114349985-114350007 CCATGATGGCAGAGGACTAAAGG - Intronic
1059449766 9:114363209-114363231 CCATGAGCTCTGGGGCCAGAGGG - Intronic
1059574529 9:115475025-115475047 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1060318561 9:122534661-122534683 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060739279 9:126087635-126087657 TCATGAGGGCAGAGCCCCCATGG + Intergenic
1060764403 9:126283050-126283072 CAATGGGGGAAGAGGTCAGAGGG + Intergenic
1060961600 9:127684688-127684710 CCAGCAGGTCAGAGCCCAGAGGG - Intronic
1061064404 9:128268382-128268404 ACAGGAGGGCAGTGGGCAGAGGG + Intronic
1061232349 9:129322092-129322114 CCATGAGGGCAGGAACCACATGG + Intergenic
1061246911 9:129405312-129405334 TCATGTGGGCTGAGGGCAGAGGG - Intergenic
1061723079 9:132565725-132565747 CCAGGAAGGCAGAGCCCACATGG - Intronic
1061819398 9:133217719-133217741 CGGTCAGGGCAGAGGCCAGCAGG - Intergenic
1062123613 9:134847846-134847868 ACAGCAGGGCAGAGGCCAGAGGG + Intergenic
1062235743 9:135506740-135506762 CCATGAGGATTGAGGCCAGCTGG + Intergenic
1062241288 9:135540470-135540492 CGGTCAGGGCAGAGGCCAGCAGG + Intergenic
1062478200 9:136739917-136739939 CCAGGAGGGCAAAGGGCTGAGGG + Intronic
1202790648 9_KI270719v1_random:88641-88663 CCATGAGGGCAGAGGGCGAGAGG + Intergenic
1185462335 X:339210-339232 CCGTGCAGGCAGAGGCCAGAGGG + Intronic
1185990964 X:4893254-4893276 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1187311397 X:18147065-18147087 TCAAGAAGCCAGAGGCCAGAGGG + Intergenic
1188004126 X:25005657-25005679 CCCTGAGGCCAGAGGCTACAGGG - Intronic
1188430932 X:30104989-30105011 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1188463471 X:30453147-30453169 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1188517441 X:31002836-31002858 CTATGAGGGCAGAGTCCTCATGG + Intergenic
1188517669 X:31004972-31004994 CTATGAGGGCAGAGTCCTCATGG + Intergenic
1188552558 X:31379162-31379184 CGAGGAGGGGAGAGGTCAGATGG - Intronic
1189354018 X:40298089-40298111 CAATGAGGATAGGGGCCAGAGGG + Intergenic
1189380018 X:40496083-40496105 CCATGAGGGCAGAGTCCCCAGGG - Intergenic
1189774498 X:44458260-44458282 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1189916174 X:45857826-45857848 CCATGAGAGCAGAGCCCTCATGG + Intergenic
1190760619 X:53434787-53434809 CCAGGAGGGCACAGTCCAGGTGG + Intergenic
1192704753 X:73518064-73518086 CCATGAGAGCAGAGTCCTTATGG + Intergenic
1194186339 X:90777365-90777387 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1194293713 X:92104282-92104304 CGAGGAGGGGAGAGGTCAGATGG + Intronic
1194308626 X:92277092-92277114 CGAGGAGGGGAGAGGTCAGATGG + Intronic
1194822860 X:98528318-98528340 CAAGGAGGGGAGAGGTCAGATGG + Intergenic
1194873895 X:99163494-99163516 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1194935329 X:99940775-99940797 CCATGAGGGCAGAGACCTGGTGG - Intergenic
1195326962 X:103765865-103765887 GGAGGAGGGCAGAGGTCAGATGG + Intergenic
1195908770 X:109869261-109869283 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1196572412 X:117280825-117280847 CAAGGAGGGGAGAGGTCAGATGG - Intergenic
1196773947 X:119321811-119321833 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1197349125 X:125360484-125360506 TCATCAGGGCAGAGGCCTCATGG - Intergenic
1197470868 X:126864742-126864764 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1197932984 X:131713702-131713724 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1198120725 X:133590005-133590027 CCATGAGGGCAGAGCTCTCATGG - Intronic
1198137977 X:133773292-133773314 TCATGAAGGCAGAGCCCAGGCGG + Intronic
1198186560 X:134259112-134259134 CCAAGACAGCAGAGGCCAGGTGG - Intergenic
1198577319 X:138024862-138024884 TCCTGCGGGCAGAGGCAAGATGG + Intergenic
1198742732 X:139857981-139858003 TCATGAGGGCAGAGCCCTTATGG - Intronic
1198983848 X:142427625-142427647 CGAGGAGGGGAGAGGTCAGATGG + Intergenic
1199576387 X:149317325-149317347 CGAGGAGGGGAGAGGTCAGATGG - Intergenic
1199868129 X:151872674-151872696 CCACCAGTGCAGAGCCCAGATGG + Intergenic
1200078733 X:153565141-153565163 CCAAGAGGGTAGAGGCAAGCTGG + Intronic
1200182935 X:154162253-154162275 CCAGAAGGACAGAGGCCAGGGGG + Intergenic
1200188589 X:154199367-154199389 CCAGAAGGACAGAGGCCAGGGGG + Intergenic
1200194238 X:154236508-154236530 CCAGAAGGACAGAGGCCAGGGGG + Intergenic
1200199994 X:154274311-154274333 CCAGAAGGACAGAGGCCAGGGGG + Intronic
1200532933 Y:4359442-4359464 CGAGGAGGGGAGAGGGCAGATGG + Intergenic
1200611232 Y:5328823-5328845 CAAGGAGGGGAGAGGTCAGATGG + Intronic