ID: 1142431845

View in Genome Browser
Species Human (GRCh38)
Location 16:90032893-90032915
Sequence GTTCTTCACCACCACCTCAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 1, 2: 2, 3: 14, 4: 159}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142431845_1142431854 2 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431854 16:90032918-90032940 GCGGCTGGTAGGTGTGGCGGGGG 0: 1
1: 0
2: 0
3: 18
4: 239
1142431845_1142431856 12 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431856 16:90032928-90032950 GGTGTGGCGGGGGCACCTGGAGG 0: 1
1: 0
2: 0
3: 38
4: 444
1142431845_1142431859 27 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431859 16:90032943-90032965 CCTGGAGGCTGACAGGTTGTTGG 0: 1
1: 0
2: 0
3: 21
4: 270
1142431845_1142431849 -4 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431849 16:90032912-90032934 GAACCTGCGGCTGGTAGGTGTGG 0: 1
1: 0
2: 0
3: 8
4: 151
1142431845_1142431860 28 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431860 16:90032944-90032966 CTGGAGGCTGACAGGTTGTTGGG 0: 1
1: 0
2: 0
3: 32
4: 276
1142431845_1142431855 9 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431855 16:90032925-90032947 GTAGGTGTGGCGGGGGCACCTGG 0: 1
1: 0
2: 2
3: 22
4: 305
1142431845_1142431848 -9 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431848 16:90032907-90032929 GTGAAGAACCTGCGGCTGGTAGG 0: 1
1: 0
2: 0
3: 13
4: 109
1142431845_1142431857 20 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431857 16:90032936-90032958 GGGGGCACCTGGAGGCTGACAGG 0: 1
1: 0
2: 5
3: 40
4: 346
1142431845_1142431853 1 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431853 16:90032917-90032939 TGCGGCTGGTAGGTGTGGCGGGG 0: 1
1: 0
2: 0
3: 10
4: 146
1142431845_1142431851 -1 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431851 16:90032915-90032937 CCTGCGGCTGGTAGGTGTGGCGG 0: 1
1: 0
2: 1
3: 23
4: 246
1142431845_1142431852 0 Left 1142431845 16:90032893-90032915 CCAGTGAGGTGGTGGTGAAGAAC 0: 1
1: 1
2: 2
3: 14
4: 159
Right 1142431852 16:90032916-90032938 CTGCGGCTGGTAGGTGTGGCGGG 0: 1
1: 0
2: 1
3: 23
4: 338

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142431845 Original CRISPR GTTCTTCACCACCACCTCAC TGG (reversed) Exonic
900379704 1:2377763-2377785 GCTCTTCACCCCCACCTCCCAGG - Intronic
901236341 1:7669587-7669609 GCTCCTCACCCCCACCTCCCAGG + Intronic
901878023 1:12178057-12178079 CTCCTCCACCACCACCTCATTGG - Intronic
903061713 1:20673146-20673168 GATCTTCACCTTCACCTCCCGGG - Intronic
903671867 1:25040769-25040791 TTTCTTCCCCACCCCCTTACAGG + Intergenic
904498138 1:30898982-30899004 ACTCCTCACCACCACCTAACGGG + Intronic
907273300 1:53303280-53303302 GCTGCTCCCCACCACCTCACTGG - Intronic
907513543 1:54979655-54979677 GTTAGTCACCCCCAGCTCACTGG + Intergenic
907773017 1:57484863-57484885 CTTGTTCACCAGCACCACACAGG - Intronic
910610110 1:89132597-89132619 TTTCCTCAGCACCATCTCACTGG + Intronic
910854633 1:91683468-91683490 CTTCTCCACCAGCCCCTCACAGG - Exonic
911660132 1:100491930-100491952 GTTCTTCCCCAGCTCCTCTCGGG - Intronic
912230345 1:107785642-107785664 GTTTTTCTCCACAACCCCACAGG - Intronic
914826750 1:151142772-151142794 GTTCTTTTCCCCCACCCCACAGG - Intronic
916408569 1:164522224-164522246 CTGCCTCACCAACACCTCACAGG + Intergenic
916911553 1:169353496-169353518 TTTCTTGACCACCACCACACAGG + Intronic
919578577 1:199342259-199342281 GTTTTTCTCCACAGCCTCACTGG - Intergenic
920032159 1:203044028-203044050 CTTCAGCACCTCCACCTCACTGG - Intronic
922571218 1:226635661-226635683 GTTCTTCACCACCCCCGCCCCGG - Intronic
923696052 1:236253581-236253603 CTTATTCACCACCATGTCACTGG - Intronic
924273446 1:242359227-242359249 CTACTTCACTCCCACCTCACAGG - Intronic
924809528 1:247388981-247389003 GTTCTTCCCCACCCTTTCACAGG - Intergenic
1063004566 10:1955995-1956017 GTTCTGAACAAACACCTCACTGG - Intergenic
1065155195 10:22862536-22862558 ATTCTTCACCACCACCTTACGGG + Intergenic
1067479368 10:46585127-46585149 GTGGCTGACCACCACCTCACTGG - Intronic
1067553203 10:47249397-47249419 GTTCTTCAGCAGCACCAAACAGG + Intergenic
1067615370 10:47756674-47756696 GCTGACCACCACCACCTCACTGG + Intergenic
1068620562 10:59176900-59176922 GTTTTTGATCACCTCCTCACAGG - Exonic
1070988936 10:80714683-80714705 GGCCCTCATCACCACCTCACGGG + Intergenic
1071630772 10:87216625-87216647 GCTGACCACCACCACCTCACTGG + Intergenic
1072634866 10:97171362-97171384 GTCCTGCAGCGCCACCTCACAGG + Intronic
1078027795 11:7714719-7714741 CTTGTTCTCCACAACCTCACCGG + Intergenic
1078720457 11:13879300-13879322 TTTCTTCACCTCCTCCTCATAGG - Intergenic
1081614872 11:44584879-44584901 GTTCTTGGCCACCAGCTCTCTGG - Intronic
1083166293 11:60890167-60890189 CTTCATCACCACCACTTCAGAGG + Intergenic
1085302937 11:75468920-75468942 TGACATCACCACCACCTCACAGG + Intronic
1086941204 11:92800435-92800457 GTTGTTCACCAGCACTGCACAGG + Exonic
1089519083 11:119051933-119051955 GTTCTTCCCCAGCTCCTCCCTGG + Exonic
1090366304 11:126209523-126209545 GTACTTCTTCACCACCTGACGGG + Exonic
1090798658 11:130156813-130156835 CTTCTCCACCACCCCCTCACTGG - Intergenic
1092697784 12:11192675-11192697 CTTTTTCTCCACAACCTCACTGG - Intergenic
1092961289 12:13598815-13598837 GTTCTACCCCACCACTTCCCTGG + Intronic
1093563976 12:20579640-20579662 GTTCCTCAGCACCAGCTCTCAGG + Intronic
1096080502 12:48829350-48829372 GTTCTGCACCATCCCCTCCCAGG + Intergenic
1096909084 12:54963823-54963845 ATTTTTCACCACCCCCTCTCAGG - Exonic
1100271396 12:93028879-93028901 GTTCTTCACCAACACCTCACAGG + Intergenic
1100573363 12:95863945-95863967 GTTCTTCACCATCACTTAACAGG - Intronic
1100618402 12:96249358-96249380 GCGCGTCACCACCAGCTCACAGG - Intronic
1101434159 12:104650845-104650867 ATTCTTAACCACCTCCACACTGG - Intronic
1103405950 12:120675386-120675408 TTTCTTCACATCCACCCCACAGG - Intergenic
1106123766 13:26883254-26883276 GTCCTTCCCCACCCCCTCCCAGG + Intergenic
1109560966 13:64049788-64049810 GTTTTCCCCCACCACCTAACGGG + Intergenic
1111559464 13:89925953-89925975 CTTTTTCACTACCACCACACTGG + Intergenic
1112221753 13:97498229-97498251 GTGCTTCCCCTACACCTCACTGG - Intergenic
1112901490 13:104363034-104363056 GTGCTCCACCACCACATCATGGG + Intergenic
1113618362 13:111696646-111696668 GTTCCTCAGCACCACCTCCAAGG - Intergenic
1113623892 13:111781907-111781929 GTTCCTCAGCACCACCTCCAAGG - Intergenic
1114533075 14:23407400-23407422 GTCCTTCAGCATCACCTCAGAGG - Intronic
1114992083 14:28299472-28299494 CTGCTTCTCCAGCACCTCACAGG - Intergenic
1117051381 14:51863475-51863497 GGTCTTTACCACTGCCTCACAGG + Intronic
1117553065 14:56855899-56855921 GTTTTTGTCCACCACCCCACTGG + Intergenic
1118711162 14:68520724-68520746 GTTCTTCCCCACACCCTAACTGG - Intronic
1119170855 14:72535296-72535318 GTTCTTGGCAACCACATCACAGG - Intronic
1121094070 14:91203619-91203641 GATCTACAGCACCACCTCAAAGG + Intronic
1121220528 14:92281474-92281496 GTTCTTCAGCATCTCCTCAGGGG + Intergenic
1122150888 14:99725591-99725613 TTCCTCCACAACCACCTCACAGG - Intronic
1125575104 15:40749911-40749933 GCTCTTCACCACCACTCCACAGG + Intronic
1126078867 15:44939107-44939129 CTTCATCACCACCACCTCCAAGG - Intergenic
1126674222 15:51145612-51145634 ATGGTTCACCACCACCTCTCTGG + Intergenic
1130103712 15:80913222-80913244 TTTCTTCACCACCAACTCTTGGG + Intronic
1134568150 16:15268822-15268844 TTTCATTACCACCACCTGACAGG + Intergenic
1134734283 16:16487533-16487555 TTTCATTACCACCACCTGACAGG - Intergenic
1134933218 16:18224746-18224768 TTTCATTACCACCACCTGACAGG + Intergenic
1140057379 16:71537156-71537178 GGCCTTCTCCACCACCTCAAAGG - Exonic
1142431845 16:90032893-90032915 GTTCTTCACCACCACCTCACTGG - Exonic
1142806430 17:2373383-2373405 CTGCCTCACCACCACCTCGCAGG - Exonic
1143686132 17:8517599-8517621 GTTCTCCACCACCACCTTCTTGG + Intronic
1144647076 17:16982291-16982313 GTTCCCCACCCCCACCACACTGG - Intergenic
1146761995 17:35487197-35487219 GCTCTGCACCAACACCTCACGGG + Intronic
1150683251 17:67300229-67300251 TTTATTCACCACCCACTCACTGG + Intergenic
1152874983 17:82781345-82781367 GTTCCCCACCACAACCTCTCAGG - Intronic
1157539656 18:48491326-48491348 GCTCTTCACCTCCACTTCAGCGG + Intergenic
1158435681 18:57434515-57434537 CCTCCTCACCTCCACCTCACCGG + Intergenic
1167998177 19:53423572-53423594 GATGTTCACCACCAGCTGACTGG - Intronic
1168007654 19:53504166-53504188 GATGTTCACCACCAGCTGACTGG - Intergenic
928172543 2:29012652-29012674 CTTCTTCACCTCCACCCCAAAGG - Intronic
934729049 2:96644903-96644925 CATCTTCCCCACCACCTCATGGG + Intergenic
935237531 2:101151218-101151240 GTTCTTCAGCAGCACCTCCTCGG + Exonic
935295820 2:101648431-101648453 ATTCTTCAGCACCACCTCAGGGG - Intergenic
935975128 2:108570692-108570714 GCTCTTCTCCACCGCCTCCCAGG - Intronic
936279587 2:111125691-111125713 ATTTCTCCCCACCACCTCACAGG - Intronic
942964795 2:181878928-181878950 ATTCTTCACCAACCCCTCCCTGG + Intergenic
945029351 2:205649158-205649180 GTTCCTCAGCACCACCTCTGGGG - Intergenic
945785768 2:214234522-214234544 CTTTTTCTCCACAACCTCACTGG + Intronic
947802140 2:232936226-232936248 AATCTCCACCTCCACCTCACCGG - Intronic
948411197 2:237762609-237762631 ATTTTTCACCTCCACTTCACTGG - Exonic
948411328 2:237763777-237763799 ATTCTTCACCACCAGCCCTCGGG - Exonic
1172610165 20:36244905-36244927 CTTCCTCACCAGCACCTTACAGG + Exonic
1172699767 20:36845849-36845871 GCTCCTCACCCCCACCTCCCAGG - Intronic
1174148812 20:48471457-48471479 ATTCTGCACCAAAACCTCACGGG + Intergenic
1176146397 20:63567407-63567429 GGTGGTCACCACCACCTCCCAGG - Exonic
1178008257 21:28249233-28249255 ATATTTCACCACCACTTCACAGG + Intergenic
1179136205 21:38682229-38682251 GGTTCTCACCACCACCCCACTGG - Intergenic
1183833101 22:40429646-40429668 GTTCTTCTCCACCAGCTCCATGG + Exonic
952579246 3:34811722-34811744 CATATTCACCACCACCTTACAGG - Intergenic
953068272 3:39494992-39495014 TTTTTGCTCCACCACCTCACAGG + Intronic
954198126 3:49008056-49008078 GATCTTCACCCCCACCTTAGGGG - Intronic
954575858 3:51675863-51675885 GTACTTCCCCACCACCTGGCTGG - Intronic
954977611 3:54711520-54711542 GTTCTTCCCTACCCCCACACAGG + Intronic
955311059 3:57886919-57886941 ATTCCCCACCTCCACCTCACCGG - Intronic
955619738 3:60850063-60850085 ATTCTTCCCCATCCCCTCACAGG + Intronic
956389602 3:68757343-68757365 ACTCTTTATCACCACCTCACAGG + Intronic
956529160 3:70198632-70198654 GTTCTTTACCACCATCTTTCTGG - Intergenic
966371882 3:179259360-179259382 ATTCTTCACCACCAGCCCTCGGG + Intronic
966372011 3:179260525-179260547 ATTCTTCACCTCCACCTCACTGG + Intronic
967627278 3:191701907-191701929 CTTCTTTGCCACCACCTCATTGG - Intergenic
968669509 4:1841488-1841510 CTTCTTCACCACCACCTCTGCGG + Exonic
969297595 4:6279003-6279025 GCTCTTCACCACCCCCACATTGG - Intronic
969309381 4:6344258-6344280 ATTCTTCACCCCCAGCTCCCAGG - Intronic
970696801 4:18687397-18687419 GTTGGTCACCACCATCCCACAGG - Intergenic
970880352 4:20921100-20921122 GTTCTTCATCACCTCTTAACTGG - Intronic
971611902 4:28736589-28736611 TTTCTTCAACACTACCTCACTGG - Intergenic
972782826 4:42300893-42300915 GTTTTTCACCACCACCCTCCAGG - Intergenic
975450399 4:74518835-74518857 GTTCTTCACCATCCAATCACAGG - Intergenic
977740167 4:100470396-100470418 CTTTTTCTCCACAACCTCACTGG - Intronic
981682365 4:147414277-147414299 CTTTTTCTCCACAACCTCACTGG + Intergenic
984387024 4:179073940-179073962 TTTTTTCTCCACAACCTCACCGG - Intergenic
986102842 5:4629970-4629992 GTGTTTAACAACCACCTCACTGG - Intergenic
991696906 5:69281441-69281463 GATCATCACAACCATCTCACAGG + Exonic
993414622 5:87611502-87611524 TTTCTCCACCTCCACCTTACTGG + Intergenic
995664492 5:114526111-114526133 CTTTTTCTCCACAACCTCACTGG - Intergenic
997241714 5:132312593-132312615 CTGCTCCACCACCACCTCAGGGG + Intronic
998786518 5:145715672-145715694 GTACTTCACACCCACCACACTGG + Intronic
1003520998 6:6858276-6858298 GTTCTACCCCACCACATCCCAGG + Intergenic
1004537300 6:16515244-16515266 TTTTTTCTCCACCATCTCACGGG + Intronic
1005802361 6:29440253-29440275 CTACTTCACCACCTCCTTACTGG + Exonic
1005849998 6:29814033-29814055 ATGAGTCACCACCACCTCACTGG + Intergenic
1007387081 6:41527553-41527575 GTTCTTCACTACCACACCAATGG + Intergenic
1010507813 6:76681953-76681975 GTTCTTGGCCACCTTCTCACTGG - Intergenic
1012386458 6:98688942-98688964 GCTGTTCACCACCATCTCACAGG + Intergenic
1012928953 6:105296964-105296986 CTTCTTAACCAGCCCCTCACAGG - Intronic
1013465966 6:110417345-110417367 TTTCCCCACCACCCCCTCACCGG - Intergenic
1013592080 6:111627453-111627475 GTTCTTCTCCTCCACCTATCTGG - Intergenic
1014314608 6:119847965-119847987 CTTAATTACCACCACCTCACCGG + Intergenic
1015857737 6:137643499-137643521 CTTTTTCTCCACAACCTCACCGG - Intergenic
1015926899 6:138319835-138319857 GTGCTCCACCACCAGCTCACAGG - Exonic
1016116528 6:140291759-140291781 GTAATTCATCACCACCTGACTGG + Intergenic
1017009210 6:150051742-150051764 ATTCTGCACCAAAACCTCACAGG + Intergenic
1022832169 7:34078977-34078999 GTTCTTCACCAGCACCTGGAAGG - Exonic
1022860758 7:34364148-34364170 GGTCTGCACCACAGCCTCACAGG + Intergenic
1025234079 7:57222031-57222053 ATTCTACACCAAAACCTCACGGG - Intergenic
1025635446 7:63316476-63316498 GTGCTCCACCCCCACCCCACAGG + Intergenic
1025647249 7:63431694-63431716 GTGCTCCACCCCCACCCCACAGG - Intergenic
1028978997 7:96945968-96945990 GTGCTTCATCTCCACCTAACGGG - Intergenic
1031401244 7:121328593-121328615 TTTCTTCTCCTTCACCTCACAGG - Intronic
1036393945 8:8350654-8350676 GCTCTTAACCACCACATCATTGG - Intronic
1036588609 8:10147705-10147727 GTGCTCAACCACCAGCTCACAGG + Intronic
1037878018 8:22558292-22558314 GTTCTTCTCCACCTTCTCCCAGG + Intronic
1043457509 8:80427160-80427182 CTTCTTCTCCATCACCTTACCGG + Intergenic
1044624585 8:94224404-94224426 GTTTTTCACCAGCACCTGCCAGG - Intergenic
1045173490 8:99696293-99696315 CTTATTCACCACCACCTCTGTGG - Intronic
1045798939 8:106079257-106079279 GTCCTTCACCACCATCTCTCTGG - Intergenic
1047889771 8:129294829-129294851 GATCATCACCATCACCTCCCAGG + Intergenic
1052418433 9:28208285-28208307 GTTCTCCTCCCCCACCCCACAGG - Intronic
1055869675 9:80859865-80859887 TTTCTTCAACTCCAACTCACTGG - Intergenic
1057101008 9:92359866-92359888 TTTCTTCACCCCCACCCCCCTGG - Intronic
1059792979 9:117660769-117660791 GTTCTCCTACACCAACTCACAGG - Intergenic
1062027605 9:134347687-134347709 GTCCTTCTCCACCTCCCCACCGG - Intronic
1187333591 X:18362668-18362690 TTTCTTCCCAACCACCACACTGG - Intergenic
1187925985 X:24250481-24250503 GTTATGCACCACCACCTGCCTGG + Intergenic
1187993442 X:24900478-24900500 ATTCTTCACCAACACCACATTGG + Intronic
1188146339 X:26618280-26618302 ATTCTTCACCAACACCTTCCTGG - Intergenic
1189919343 X:45888139-45888161 GTGATTGACCACAACCTCACTGG - Intergenic
1191902885 X:66056809-66056831 TTTCTGCCTCACCACCTCACCGG + Intergenic
1192552366 X:72064645-72064667 GTTCATCATTACCACCTCACTGG - Intergenic
1198778492 X:140207559-140207581 GTTCTTTACTAACAACTCACCGG - Intergenic
1201528360 Y:14961822-14961844 GTTCTTTCCCACCTCCTCATAGG - Intergenic