ID: 1142432018

View in Genome Browser
Species Human (GRCh38)
Location 16:90034105-90034127
Sequence CTAAGGTTCTTCCTGGCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 266
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 242}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142432013_1142432018 14 Left 1142432013 16:90034068-90034090 CCCTCTGAGAACTTGGGCAGAGG No data
Right 1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG 0: 1
1: 0
2: 3
3: 20
4: 242
1142432015_1142432018 13 Left 1142432015 16:90034069-90034091 CCTCTGAGAACTTGGGCAGAGGA 0: 1
1: 0
2: 1
3: 22
4: 264
Right 1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG 0: 1
1: 0
2: 3
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142432018 Original CRISPR CTAAGGTTCTTCCTGGCTGC TGG Intronic
901140058 1:7022912-7022934 CTAAATTTCATCCTGGCTTCCGG - Intronic
902702205 1:18180044-18180066 GTGAGGTTCTTCCTGGCTTTTGG + Intronic
902841228 1:19075249-19075271 CTCTGGCTCTCCCTGGCTGCAGG + Intronic
909937489 1:81569946-81569968 CTAAGTTTCTCCCTAGCTGTTGG + Intronic
910743872 1:90551990-90552012 CTATGATTCATGCTGGCTGCTGG + Intergenic
911453898 1:98099145-98099167 TTAAGGAATTTCCTGGCTGCAGG + Intergenic
912871168 1:113308280-113308302 CTAGAGTCCTTCCTGGCTGGGGG - Intergenic
913133641 1:115865591-115865613 CTAAGGTCCTTCCTTCCTCCGGG - Intergenic
915491345 1:156251623-156251645 TTAAGTGGCTTCCTGGCTGCTGG + Intronic
916029242 1:160862145-160862167 TCCAGCTTCTTCCTGGCTGCTGG + Intronic
917833022 1:178913861-178913883 CCAAGGTGCTCCCAGGCTGCTGG + Intronic
919289492 1:195611019-195611041 CTCAGTTTCTTGCTGGCTGTTGG - Intergenic
920676800 1:208043745-208043767 CCAAGGTTCCTCCTGGCAACAGG - Intronic
920868605 1:209774220-209774242 ATAAAATTCCTCCTGGCTGCAGG - Intronic
921641668 1:217562084-217562106 CTAAGGTTGATCTTGACTGCTGG - Intronic
921741913 1:218695009-218695031 CTGAGGTGCTTTCTGGCTTCTGG + Intergenic
921905587 1:220492393-220492415 CTCAGTTTCTTGCTGGCTGTTGG - Intergenic
922062310 1:222104298-222104320 CAAAGGTCCTTGCCGGCTGCTGG - Intergenic
923040830 1:230318789-230318811 CTATGGTTCTTTCTGGCTCAGGG + Intergenic
923384814 1:233455347-233455369 CTAAGGTTGGCCCTTGCTGCGGG + Intergenic
924331797 1:242946913-242946935 CTGAGGTGCTTCCAGACTGCTGG - Intergenic
924635379 1:245782247-245782269 ATAAGATTATTCATGGCTGCAGG - Intronic
1063275110 10:4557545-4557567 CTGAGGTGCTCCCTGACTGCTGG + Intergenic
1065283294 10:24162833-24162855 CTCAGTTTCTTGCTGGCTGTTGG + Intronic
1066998525 10:42584914-42584936 CTGAAACTCTTCCTGGCTGCAGG - Intronic
1067663774 10:48256218-48256240 CAAGGGTTCTTCCTGGGTGGGGG - Intronic
1069911420 10:71762084-71762106 CTAAGGTTCTTCCCCGCTCTGGG - Intronic
1070471408 10:76783858-76783880 CTCAGATTCTTGCTGGCTGCTGG - Intergenic
1070564172 10:77590916-77590938 CTTGGTTTCTTCCTGGCTCCAGG - Intronic
1071470603 10:85981475-85981497 CCAAGGTTCCTAGTGGCTGCTGG - Intronic
1071754614 10:88522931-88522953 CCAAAGAACTTCCTGGCTGCAGG + Intronic
1072822314 10:98570105-98570127 CAAAGGTTCCTCCTGGCAGGTGG + Intronic
1072997335 10:100257057-100257079 CTATGGTTATTCCTGGCTTGTGG + Intronic
1073052545 10:100677417-100677439 CTAAGGTTCTTCCTGCCTGGGGG + Intergenic
1073889389 10:108081473-108081495 ATAGGTTTCTTCCTGACTGCAGG + Intergenic
1074162520 10:110846171-110846193 CTCTGGTAATTCCTGGCTGCAGG - Intergenic
1074571332 10:114626943-114626965 CTATGCTTCTCCCTGGCTTCTGG - Intronic
1075715581 10:124553359-124553381 CTCAGGTGCATCCTGGCTGCAGG - Intronic
1076073832 10:127515907-127515929 CTACGTTTTTTCATGGCTGCAGG - Intergenic
1076624994 10:131816273-131816295 CAAAGGTCATTCCTGGCTGCAGG + Intergenic
1077815111 11:5679422-5679444 GTAAGTTTTTTCCTTGCTGCAGG - Intronic
1078443462 11:11386394-11386416 CTCAGGATCTCCCTGGCTTCTGG + Intronic
1078930964 11:15911846-15911868 CTTAGGTCCTCGCTGGCTGCTGG - Intergenic
1079008629 11:16810489-16810511 CCAAGCCTCTTCCAGGCTGCTGG + Intronic
1080745554 11:35105492-35105514 CTCAGGTCCTCTCTGGCTGCTGG + Intergenic
1081209454 11:40313804-40313826 CGAAGTTTCATCCTGGCTACAGG + Intronic
1081427317 11:42939701-42939723 CCAATGTCCTTCCTGGCTGGTGG - Intergenic
1083347643 11:62004740-62004762 GTAAGCTTGTTCTTGGCTGCAGG - Intergenic
1084555804 11:69875128-69875150 CGAAGGGCCCTCCTGGCTGCTGG - Intergenic
1085557943 11:77442482-77442504 CTCAGTTTCTTCCTGGCTGTTGG - Intronic
1085829059 11:79880289-79880311 TTAAGGTTCTTCCTGCTTGGAGG + Intergenic
1086098126 11:83071053-83071075 CGAAGGTTCTTTCAGGCTGCTGG - Intronic
1087088480 11:94243981-94244003 CTCAAGTTCTTGCTGGCTGTTGG - Intergenic
1087388213 11:97500838-97500860 CTCAGTTTCTTGCTGGCTGTAGG - Intergenic
1088906607 11:114159887-114159909 CTACTGTTCTTCCAGGCTGTGGG - Intronic
1089412400 11:118256977-118256999 CTAAGGTTATTTGTGGCTTCGGG - Intronic
1090217566 11:124983659-124983681 CTAAGGTGTTCCCAGGCTGCTGG + Intronic
1091689170 12:2584042-2584064 CCAAGGGTCTTCGTGGGTGCAGG + Intronic
1091995179 12:4987708-4987730 AGAAAGGTCTTCCTGGCTGCCGG + Intergenic
1093588096 12:20867001-20867023 CCAAGGTACTTCCTGTCTTCAGG - Intronic
1094702382 12:32882108-32882130 ATAATGTTCTGCCTGGCTGTGGG - Intronic
1097707689 12:62884861-62884883 TTCAAGTTCATCCTGGCTGCTGG + Intronic
1097823340 12:64149645-64149667 CTAAGATTCTTACAGGGTGCAGG - Exonic
1102165247 12:110801014-110801036 CTCAGTTTCTTGCTGGCTGTTGG - Intergenic
1102857178 12:116304296-116304318 CTACTGTTCTTTTTGGCTGCAGG + Intergenic
1103310205 12:120000248-120000270 CTAAAGATCTTCTTGCCTGCAGG + Intronic
1105766855 13:23568347-23568369 CTAAAGGTCGGCCTGGCTGCAGG - Intergenic
1112259864 13:97868254-97868276 TTAAGTTTCTTCCTGGCTCAGGG - Intergenic
1112552118 13:100431122-100431144 CTTAGGTTTTTCCTGACTGGTGG + Intronic
1112776598 13:102850378-102850400 CTAAGCTCCTTCCTGCCTCCAGG - Intronic
1113413373 13:110109325-110109347 CTAAGGTGCTTGCTGGCTAAGGG + Intergenic
1115967194 14:38904119-38904141 TTCATATTCTTCCTGGCTGCAGG + Intergenic
1117766333 14:59087225-59087247 ATAAGGTTCTTCCTGGGGGTAGG - Intergenic
1120768290 14:88352039-88352061 CTATGGTTCTTCCAGGCTGTTGG + Intergenic
1120955561 14:90079116-90079138 CTCAGGTTCAACATGGCTGCTGG + Intronic
1122023125 14:98855847-98855869 CCCAGGTCCTGCCTGGCTGCAGG - Intergenic
1122997739 14:105274646-105274668 CCAAGGTTCCTCCTGCCTGCAGG - Intronic
1126545877 15:49873712-49873734 CTAAGTTTCTGCCTGGCTGCAGG + Intronic
1127900387 15:63336750-63336772 CTTTGCTTCCTCCTGGCTGCAGG - Intronic
1128185851 15:65642840-65642862 CAAAGGCTCTGCCTGGCTCCAGG - Intronic
1128593927 15:68928131-68928153 CTCAGGTCCTTACTGGCTGTTGG + Intronic
1129931275 15:79412827-79412849 CCAAGGTGCTCCCTGACTGCTGG - Intronic
1130686836 15:86045369-86045391 CTATGGTTCTCTCTGGCTGCAGG - Intergenic
1131182100 15:90247509-90247531 CCAATGTCCTTCCTGGCTGATGG - Intergenic
1131649123 15:94379549-94379571 CTAGGGTGGTTCCTGGCTCCTGG + Intronic
1132317845 15:100902891-100902913 CGCAGGTCCTCCCTGGCTGCTGG - Intronic
1133545273 16:6800273-6800295 CTAAGGTGTTTCCAGGGTGCTGG - Intronic
1133764422 16:8827213-8827235 CTAAGGTACTTTCTGACAGCTGG - Intronic
1135475019 16:22766287-22766309 CTTAGTTTCTTGCTGGCTGTTGG - Intergenic
1136025940 16:27469228-27469250 CTCAGGGTCTTCCTGGATGATGG + Intronic
1138162003 16:54763095-54763117 CAAGGCTTTTTCCTGGCTGCTGG + Intergenic
1139897551 16:70299580-70299602 CTATGATTCTTCCTGGTTCCAGG - Intronic
1142008555 16:87701999-87702021 GTAAGGAGCTGCCTGGCTGCTGG - Intronic
1142330594 16:89450112-89450134 CTCAGGTTCTTCCCTGCAGCTGG - Intronic
1142359861 16:89620903-89620925 CTGAGGTTCTCCCTCGCTGACGG - Intronic
1142432018 16:90034105-90034127 CTAAGGTTCTTCCTGGCTGCTGG + Intronic
1142559053 17:799162-799184 CAAATGAGCTTCCTGGCTGCCGG + Intergenic
1142813074 17:2405019-2405041 TTAAGTTTCTTCATGGCTTCTGG + Intergenic
1143560029 17:7688290-7688312 CTAGGGCTCCTCGTGGCTGCTGG - Exonic
1146592632 17:34141275-34141297 CTAAGGTCCTTCATGGCTAAAGG - Intronic
1147282231 17:39371432-39371454 CTAAGCTTTTACTTGGCTGCAGG + Intronic
1147698426 17:42375045-42375067 TTAAGGTACTTTCTGACTGCTGG - Intronic
1148061881 17:44842440-44842462 CAAAGGTACTTTCTGGCTTCAGG + Intergenic
1149567529 17:57650587-57650609 GTATGGTTGTCCCTGGCTGCAGG - Intronic
1150209900 17:63436211-63436233 CCAAGGTGCCTCCTTGCTGCTGG - Intronic
1150550260 17:66203590-66203612 CTCAAGTTCTGTCTGGCTGCTGG - Intergenic
1151287352 17:73122489-73122511 CTGAAGTTCATCCTGGCAGCAGG - Intergenic
1151498631 17:74474646-74474668 CTCAGTTTCCTCCTGGATGCTGG - Exonic
1151570364 17:74922801-74922823 CTAAGGGTCCGCCTGTCTGCAGG + Intronic
1152101958 17:78306962-78306984 CTGAGGTTTTTGCTGGCTGGAGG + Intergenic
1152475718 17:80516789-80516811 CTGTGGTCCTGCCTGGCTGCTGG + Intergenic
1157270452 18:46271881-46271903 CCAACTTTCTCCCTGGCTGCAGG + Intergenic
1157884071 18:51349443-51349465 GTAAGGTCATTCCTGGTTGCTGG - Intergenic
1159339691 18:67119115-67119137 CTCAGATTCTTGCTGGCTTCAGG - Intergenic
1159858512 18:73617868-73617890 GTAAGTTTCTTGCTGGCTGTTGG - Intergenic
1160243301 18:77137830-77137852 CTCAGGGTCTTCCTGACTTCCGG - Intergenic
1160276819 18:77444625-77444647 CTGAGGTTTCTGCTGGCTGCTGG + Intergenic
1160495483 18:79371902-79371924 CTCAGGTTCTTGCTGGAGGCTGG - Intronic
1160571231 18:79818870-79818892 CTTCGGCTCTTCATGGCTGCCGG - Intergenic
1161637776 19:5399930-5399952 CAAAGGGTGTTCCTGGCTGAGGG + Intergenic
1162792033 19:13068169-13068191 CCCAGGCTCCTCCTGGCTGCTGG + Intronic
1162959994 19:14119937-14119959 CTAAGAATCTTCCTGGGAGCAGG + Exonic
1163734064 19:18967885-18967907 CCAAGGTGCTTCCTTCCTGCAGG - Intergenic
1166561623 19:43736440-43736462 CAAGGGCTCTTCCTGGCTTCAGG - Intronic
1166971072 19:46568278-46568300 CTCAGGTCCTTGCTGGCTGTTGG + Intronic
1168301668 19:55408157-55408179 CTAACGGTCTTCCTGGGGGCCGG + Intergenic
926857548 2:17273221-17273243 CTGAGTTTCTGCCTGGCTGGGGG + Intergenic
928220460 2:29398925-29398947 CTCAGGCTCTTCATGGCTACAGG + Intronic
928916982 2:36482848-36482870 ATAAGGTTCTTCCTCCCTGGAGG - Intronic
930338145 2:50076777-50076799 ATAGTGTTCTTCCTGTCTGCTGG - Intronic
930621440 2:53648221-53648243 CTCAGTTTCTTGCTGGCTGTTGG - Intronic
931264161 2:60645813-60645835 CTTAGCTCCTTCCTGGCTGTTGG - Intergenic
931831847 2:66060850-66060872 ACAAGGGTCTTTCTGGCTGCAGG + Intergenic
931969122 2:67566573-67566595 CTCAGGTCCTTGCTGGCTGTTGG + Intergenic
932416680 2:71577813-71577835 CTAAGGTCCTCCCTGCCTCCTGG + Intronic
932949753 2:76279141-76279163 CTGAGGATTTTTCTGGCTGCAGG - Intergenic
934589104 2:95530397-95530419 CCAAGGTTCCTCCTGGGAGCAGG + Intergenic
935522664 2:104127121-104127143 CTTAGGCATTTCCTGGCTGCTGG - Intergenic
940390238 2:153124113-153124135 CTCAGTTTCTGGCTGGCTGCTGG - Intergenic
941144263 2:161824046-161824068 GTAAGGTACTTCCTGACTTCAGG - Intronic
941471570 2:165894971-165894993 CAAAGGGTTTTCCTGGATGCAGG - Intronic
942141318 2:172980098-172980120 CTAAGCTTTTTCATGCCTGCAGG - Intronic
1169474929 20:5922914-5922936 CTCAGATTCTTCCTGGCTTCGGG - Exonic
1169527959 20:6450901-6450923 CTGAAGTTCTTCATTGCTGCAGG - Intergenic
1172024291 20:31937434-31937456 CTCATAGTCTTCCTGGCTGCTGG - Exonic
1174188810 20:48725402-48725424 CTAGGCTTCAGCCTGGCTGCTGG - Intronic
1174592750 20:51659041-51659063 CCAAGCTTCTTCCTGCCTGAGGG + Intronic
1174873525 20:54205163-54205185 CTCTGGTACTTCCTGGCTGCTGG + Intergenic
1175661678 20:60818520-60818542 TTCAGGTTTTTCCTGGCTGCAGG - Intergenic
1177503477 21:21989902-21989924 ACAAGGTACTTCCTGGCTTCAGG - Intergenic
1179468087 21:41591323-41591345 CTAAGGAGCTTCCTGCCTTCTGG - Intergenic
1182146273 22:27998713-27998735 ACAAGGGCCTTCCTGGCTGCCGG - Exonic
1183695093 22:39417218-39417240 CTAAGGTTCTTCCAGAAAGCTGG - Intronic
1184223957 22:43118493-43118515 CTGAGGTCCAGCCTGGCTGCAGG + Intronic
1184322401 22:43752533-43752555 TTGAGGTTGGTCCTGGCTGCTGG + Intronic
1185074670 22:48676825-48676847 CTAAGTTTCTTCCTGGAAGTGGG + Intronic
951042020 3:17998465-17998487 CTAAGGTTTGTCCTTGCTCCGGG + Intronic
952627166 3:35419802-35419824 CTCAGTTTCTCCCTGGCTGTAGG - Intergenic
952714011 3:36460198-36460220 CTCAGGTTCTTCCAAGCTGAGGG - Intronic
953381420 3:42475427-42475449 CTCACTTTCTTGCTGGCTGCTGG - Intergenic
953536232 3:43778889-43778911 CCCAGGTTCTTTCTGGCTGTTGG - Intergenic
954309950 3:49758416-49758438 CCAGTGTTCTTCCTGGCTGATGG - Intronic
954618847 3:51984368-51984390 CCAAGGTTACTCCTGGCAGCTGG + Intronic
956520271 3:70096155-70096177 CTCAGTTTCCTGCTGGCTGCTGG + Intergenic
956684266 3:71809786-71809808 AGACGGTTCATCCTGGCTGCAGG + Intergenic
957030410 3:75234624-75234646 CTTAGGTTCTACCTGGCTTCAGG + Intergenic
957255021 3:77825638-77825660 CTGAGGGGCTTCCAGGCTGCTGG + Intergenic
959030247 3:101290989-101291011 CTAAGGTCGTTTCTGGCTTCTGG - Intronic
959297580 3:104556871-104556893 CTAAGGTTCTCCCTTCTTGCTGG + Intergenic
959487146 3:106940044-106940066 CTAAGTTTCTTCCTGACTAAAGG - Intergenic
960680215 3:120239780-120239802 CCCAGGTACTTGCTGGCTGCAGG + Intronic
961329652 3:126131037-126131059 CGCAGGTCCTTCCTGGCTGCAGG - Intronic
961559065 3:127716364-127716386 CTAACTCTCTTCCTGGCTTCTGG + Intronic
961755359 3:129123710-129123732 CTACGCTTCATCCTGGCTCCTGG - Intronic
962545295 3:136428361-136428383 GCAAGGTACTTCCTGGCTTCAGG - Intronic
964376807 3:156055936-156055958 CTAAGGGTCTACCTGTCTCCAGG + Intronic
967126632 3:186430033-186430055 CTAAGTTTCCTCCTGGCTCTGGG + Intergenic
967287677 3:187889274-187889296 CCAAGGTTCTCCCCGGCTCCAGG - Intergenic
967976737 3:195039725-195039747 CAGAGGCTCTTCCTGGCTGCAGG - Intergenic
968001172 3:195207851-195207873 CTCAGATCCTCCCTGGCTGCTGG + Intronic
968262085 3:197333589-197333611 CTCACGTGGTTCCTGGCTGCTGG - Intergenic
968747398 4:2367393-2367415 CTCAGGCTCTGCCTGGCTGAGGG + Intronic
971252991 4:24988825-24988847 CCAAGGTCCTTCCTAGCTGAGGG - Intergenic
971381106 4:26098763-26098785 CTCAGGCTCTTGCTGTCTGCTGG + Intergenic
971500380 4:27312184-27312206 CTAAAGTTGTTCTTGGCTGTTGG + Intergenic
972215251 4:36890856-36890878 CCGAGGTTCTCCCGGGCTGCTGG + Intergenic
972858339 4:43135929-43135951 CTAAAGTTCTGCCTGGCATCAGG + Intergenic
973310723 4:48706834-48706856 CTCAGGTTCTTTCTGGCTGTTGG - Intronic
973756242 4:54076579-54076601 CCAATGTCCTTCCTGGCTGATGG - Intronic
975412784 4:74074292-74074314 CTGATATTCTTCCTGGCTGTTGG - Intergenic
975491421 4:74993262-74993284 CTCAGTTTCTTCATGGCTACTGG - Intronic
975979910 4:80145453-80145475 TTTAGGTTCTCCCTGGCTTCTGG - Intergenic
976685104 4:87805039-87805061 CTGAGGTTATTCCTGGCTCGAGG + Intronic
977028471 4:91851813-91851835 CTGAGGTGCTTTCTGTCTGCTGG - Intergenic
979204808 4:118025805-118025827 TTCAGGTTCTTGCTGGCTGTTGG + Intergenic
982418842 4:155169790-155169812 CTTAGTTTTTTGCTGGCTGCTGG + Intergenic
982534630 4:156594840-156594862 CTCAGTCTCTTGCTGGCTGCTGG - Intergenic
983514976 4:168646137-168646159 CACAGCCTCTTCCTGGCTGCAGG + Intronic
985708775 5:1416384-1416406 CTCAGGCTCTTCCAGGCCGCTGG - Intronic
985717459 5:1470578-1470600 CTGAGGTTCTTCCTGGGTCCTGG - Intronic
986505588 5:8447154-8447176 CCAAGATTCTCCCTGGCTCCTGG + Intergenic
987059123 5:14225534-14225556 CCAGGGTTCTTGCTGGCTGTTGG + Intronic
988031305 5:25766860-25766882 CTAAGGTGCTTCCTGACTTCTGG + Intergenic
988247199 5:28701985-28702007 CTAAGGTACTTCCTTTCTTCTGG + Intergenic
988722925 5:33896547-33896569 CTCAGGTTCTTACTTGCTTCAGG - Intergenic
990752023 5:59027061-59027083 CTGAGGCTCTTCTTGGCTGTAGG + Intronic
994314519 5:98316814-98316836 CTAAGTTGCTAACTGGCTGCAGG - Intergenic
994652056 5:102541410-102541432 CTAAGGTGGTTCCTGGGTGGGGG + Intergenic
996416878 5:123220261-123220283 CTATGGTTCTCCATGGCTACTGG + Intergenic
998228795 5:140346282-140346304 CTGAAGCTCTTTCTGGCTGCAGG - Exonic
998891673 5:146752802-146752824 CTATGGCTCTGCCAGGCTGCTGG - Intronic
999445133 5:151633013-151633035 CTAAGGCACTTCCTGGCAACTGG - Intergenic
1000767786 5:165313418-165313440 GTAAGATTCTTTCTGGCTTCAGG - Intergenic
1003000199 6:2325034-2325056 CCAAGGTTGTGCCTGGCAGCAGG - Intergenic
1003510840 6:6778982-6779004 CTCAGGATTTGCCTGGCTGCTGG + Intergenic
1003571534 6:7259420-7259442 CTGAGCTTCTTCCTGGCCCCGGG - Intergenic
1009240495 6:61180241-61180263 GTAGGGTTATTCCTGTCTGCAGG + Intergenic
1009328045 6:62378644-62378666 ATAAGGTACTTCCTGACTTCGGG + Intergenic
1013994697 6:116294757-116294779 CTTATGTTCTTTCTGGCTTCGGG - Intronic
1014354336 6:120386119-120386141 CCAAGGGTCATGCTGGCTGCTGG + Intergenic
1014395503 6:120923408-120923430 TTCAGTTTCTTACTGGCTGCTGG + Intergenic
1015373279 6:132480374-132480396 CCAAGTTTCTTTCTGGCTGTAGG - Intronic
1017551957 6:155518582-155518604 CTGTGGTTCTGCCTGGCTCCTGG + Intergenic
1018228537 6:161654433-161654455 CCAGGCTTCTTCATGGCTGCTGG - Intronic
1019731818 7:2632952-2632974 CCACGGTGCTTCCTGGCCGCCGG - Intronic
1022887292 7:34659619-34659641 CTCAGGTTCTGCTTTGCTGCAGG - Intronic
1027543113 7:79493040-79493062 GTAAGGTACTTCCTGACTTCAGG + Intergenic
1028455749 7:91036267-91036289 CTCAGGTTCTTGCTGGCTGTTGG + Intronic
1032292567 7:130601945-130601967 CTCAGTTTCTCCCTGGCTGTTGG - Intronic
1034501374 7:151453026-151453048 CTAAGTCTCTCCCTGGTTGCTGG - Intergenic
1035397792 7:158546547-158546569 CCAGGGTGCTTCCTGGCTGCTGG - Intronic
1036041725 8:5090899-5090921 CTAAGTTTCTTGCTAGCTGCTGG + Intergenic
1037818616 8:22124985-22125007 CTAAGGTCCCCTCTGGCTGCAGG - Intronic
1038018292 8:23532813-23532835 CTGAGTTTTCTCCTGGCTGCAGG + Intronic
1040685381 8:49865480-49865502 CTCAGCTCCTTCCTGGCTCCTGG + Intergenic
1041906947 8:63043770-63043792 CTAAGGTGCTCCCAGTCTGCTGG - Intergenic
1048261265 8:132947097-132947119 CTGAGGCTCTTGCTGCCTGCTGG + Intronic
1049093563 8:140534801-140534823 CTAAGGTTCCTCCTGTCCCCCGG + Intronic
1049787182 8:144456554-144456576 CTTGGGGTCTTCCTGGCTGGTGG - Intronic
1051194907 9:14553715-14553737 CTTAGGTTCTTCCTGCAGGCAGG - Intergenic
1052519041 9:29520035-29520057 CTATGGTTTTTCCTGGGGGCAGG + Intergenic
1055581733 9:77713094-77713116 CTGAGACTCTTCCTGTCTGCTGG + Intergenic
1055921466 9:81465666-81465688 CTATGGTGCCTCCTAGCTGCTGG - Intergenic
1056133774 9:83610408-83610430 CTCAGTTTCTTGCTGGCTGTTGG - Intergenic
1056874847 9:90318408-90318430 CTAAGGTCCTTACTGGCTGCTGG + Intergenic
1057970830 9:99555818-99555840 CTAGTGTTAGTCCTGGCTGCTGG - Intergenic
1058101320 9:100920432-100920454 CTCAGTTTCTCACTGGCTGCTGG + Intergenic
1058836032 9:108859332-108859354 CTGAGGTGCATCCTGGCTCCTGG - Intergenic
1059337364 9:113577666-113577688 CTAAGGCTCTTCCTGGCCCGGGG + Intronic
1060904379 9:127291685-127291707 CTCTGGGTCTTCCTTGCTGCAGG + Intronic
1061272804 9:129553141-129553163 CTGAAGTTCTTCCTGGCTTTTGG - Intergenic
1061669515 9:132180734-132180756 CTCTGGGTCTTCCTGGATGCTGG - Intronic
1062369940 9:136233256-136233278 GGAAGGTACTTCCTGGCTTCAGG - Intronic
1186159373 X:6760653-6760675 GTAAGTTTCTTCCTGGAGGCAGG + Intergenic
1186500897 X:10049867-10049889 CTGGGGTTCTTCCTGGTTTCTGG + Intronic
1187457686 X:19457280-19457302 CTCAGCTGTTTCCTGGCTGCTGG - Intronic
1188146898 X:26625141-26625163 TTTAGTTTCTTCCTGGCTGTAGG - Intergenic
1188771245 X:34157426-34157448 CTGAGGTGCTCCCAGGCTGCTGG + Intergenic
1189091044 X:38083140-38083162 CCAAGGCTTTTCATGGCTGCTGG + Intronic
1189409929 X:40761029-40761051 CAAAGGTCCTGCATGGCTGCTGG + Intergenic
1190506338 X:51129974-51129996 CTGAGGTGCTCCCAGGCTGCTGG + Intergenic
1192238588 X:69312368-69312390 CCTAGGTTCTTGCTTGCTGCAGG - Intergenic
1193386602 X:80880168-80880190 CTCAGATTCTGCCTGGCTGTTGG + Intergenic
1193978452 X:88152140-88152162 CTCAGTTTCTCACTGGCTGCTGG + Intergenic
1197117050 X:122845724-122845746 CTAAGCATATTCTTGGCTGCAGG + Intergenic
1201229138 Y:11846078-11846100 CTGAGGTGCTTCCAGACTGCTGG - Intergenic