ID: 1142432333

View in Genome Browser
Species Human (GRCh38)
Location 16:90036493-90036515
Sequence GCTGATGCAGCGCCACGAGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142432328_1142432333 16 Left 1142432328 16:90036454-90036476 CCACGAAGTGGAGGAGAGGAAGA 0: 1
1: 0
2: 0
3: 22
4: 253
Right 1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG 0: 1
1: 0
2: 1
3: 10
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142432333 Original CRISPR GCTGATGCAGCGCCACGAGG AGG Exonic
900490510 1:2946509-2946531 GCTGCTGCACCTCCACGCGGTGG + Intergenic
900594823 1:3475972-3475994 GGTGAGGCAGTGCAACGAGGGGG + Exonic
901057503 1:6455477-6455499 GCTGAGGCAGCGGCAGGCGGTGG + Intronic
901194466 1:7432752-7432774 GGAGATGCAGGGCCACAAGGGGG - Intronic
904033520 1:27547515-27547537 GCTGCAGCAGGGCCACGGGGTGG + Exonic
905960699 1:42040258-42040280 GCTGCTGGAGTGCCAGGAGGAGG + Intergenic
906775583 1:48526512-48526534 GCAGCTGCAGCGGCAGGAGGAGG + Intergenic
913749337 1:121944498-121944520 GTTGATGCAGCATCACGAGAAGG - Intergenic
914950788 1:152111644-152111666 GCGGCTGAAGCGCCAGGAGGAGG - Exonic
915636884 1:157193795-157193817 GGAAATGCAGAGCCACGAGGGGG + Intergenic
915671258 1:157490771-157490793 GAAAATGCAGAGCCACGAGGGGG - Intergenic
1065117849 10:22499406-22499428 GCTGAGGCAGCGGAACCAGGTGG - Intergenic
1067045788 10:42984543-42984565 GCGGGTGCAGCACCACGAGCAGG - Intergenic
1073266461 10:102230984-102231006 GCTGGTGCCGCCCTACGAGGAGG - Exonic
1073295853 10:102438251-102438273 GCTGGGGCAGGGCCAGGAGGAGG + Intergenic
1074429475 10:113381565-113381587 GCTGATGCAGCTCCACGTGGAGG - Intergenic
1076013077 10:127006193-127006215 CCTGATGCAGCCCCACCAGTGGG + Intronic
1077058152 11:605943-605965 GTTGCTGCAGCTCCACGAGGTGG + Intronic
1077122314 11:915299-915321 GCTGATGCTGAGCCCCGAGGTGG + Intergenic
1079328551 11:19514856-19514878 GCTGAAGCAGGGGCATGAGGAGG + Intronic
1081869150 11:46375464-46375486 GCTGACGCAGTGTCGCGAGGTGG + Exonic
1083753733 11:64778182-64778204 GCGGAGGCAGCGCCGCGAAGGGG + Exonic
1084274307 11:68043856-68043878 GCTGCTGCAGGGCCCCGAGGCGG - Exonic
1084361910 11:68674184-68674206 GGTGATGCAGCCCCACTCGGTGG + Intergenic
1089059400 11:115614132-115614154 GCTGATGCAGCGCCCAGCCGTGG + Intergenic
1089943222 11:122440953-122440975 GCTGAGGAAGAGCCAGGAGGGGG - Intergenic
1091823353 12:3492139-3492161 GCTGAGGCAGCGGCAGGAGACGG - Intronic
1093935255 12:24993942-24993964 GCAGATGGAGGGCCAGGAGGAGG - Exonic
1101372035 12:104138555-104138577 GCTGAGGCACCTCCACGTGGCGG - Intergenic
1102672154 12:114629329-114629351 GCTCTTGCAGCACCACGAGAAGG + Intergenic
1103281434 12:119760980-119761002 CATGATGCAGAGACACGAGGAGG - Exonic
1103359806 12:120346847-120346869 GCTGATGCTGCTGCACTAGGGGG - Intronic
1105426045 13:20296035-20296057 GCTGACCCAGCTCCAGGAGGAGG + Intergenic
1107787433 13:43970166-43970188 GCTGACGCAGTGTCGCGAGGTGG + Intergenic
1110558405 13:76885746-76885768 GCTGCTGGGGCGCCCCGAGGCGG + Exonic
1112440239 13:99419802-99419824 GCTGATGAAGCACCTGGAGGAGG - Intergenic
1118019370 14:61695485-61695507 GCTGAGGCAGCGTCAGGGGGCGG - Intergenic
1119384936 14:74252143-74252165 GATGATGCAGAGACAAGAGGAGG + Intronic
1119748255 14:77059716-77059738 GCTGACTCACCGCCAGGAGGGGG - Intergenic
1122602429 14:102928388-102928410 GCTGAGGCGGCGCCACGCGGGGG - Intronic
1126702888 15:51383615-51383637 GCTGAAGCAGTGCCAAGTGGGGG - Intronic
1127763733 15:62165063-62165085 GCTGCTGCAGCCCCTCGACGCGG + Intronic
1132336564 15:101051901-101051923 GCTCCTGCAGCGGCACGGGGAGG - Exonic
1132605671 16:792790-792812 GCTGGTGCAGCGGCTCCAGGAGG + Exonic
1139652222 16:68368213-68368235 GCTGAGGGAGCTCCATGAGGTGG + Intronic
1141954856 16:87363989-87364011 GCTGATGCAGAGCAAGGACGGGG + Intronic
1142432333 16:90036493-90036515 GCTGATGCAGCGCCACGAGGAGG + Exonic
1144778211 17:17795420-17795442 GCTGCTGCAGTGCCCCGAGGTGG + Exonic
1149517793 17:57293444-57293466 GCTGTTGCAGCGTGAGGAGGAGG - Intronic
1150134929 17:62690262-62690284 GCTGCTGCTGGGCCACAAGGAGG + Exonic
1152520873 17:80855895-80855917 GGGGAAGCAGCACCACGAGGTGG - Intronic
1156204668 18:34872745-34872767 GCTGCTCCAGCACCACAAGGTGG + Intronic
1161170129 19:2808372-2808394 GCTGCTGCAGCATGACGAGGTGG + Exonic
1162517214 19:11155668-11155690 GCTGCTGGGGCGCCACGAGCAGG - Exonic
1167569276 19:50276838-50276860 GCTGAGGCAGCGCCACGGCCAGG + Exonic
1167739312 19:51314539-51314561 GCTGTGGCAGAGCCAGGAGGTGG + Intronic
1168072586 19:53961211-53961233 GATGATGAAGGGCTACGAGGAGG + Intergenic
1168713402 19:58514071-58514093 GCTGCTGGAGCGCCACCTGGCGG - Exonic
925020869 2:566812-566834 GCTGAAGCAGAACCACGTGGTGG + Intergenic
926801234 2:16662816-16662838 GCTGATGTAGGGCCCAGAGGTGG - Intronic
928456798 2:31429799-31429821 GCTGATGCAGGGCCTGGTGGAGG + Intergenic
929511431 2:42568625-42568647 GCTGCTGCCTCGCCACGGGGGGG - Intronic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
931091974 2:58896109-58896131 GCTGATGCAGCCCCAGGCTGGGG - Intergenic
943808908 2:192159732-192159754 GCTGAAGCAGGGCAATGAGGTGG - Intronic
948661298 2:239508144-239508166 GCTGCTGCAGCGCCCTGTGGCGG + Intergenic
1168973606 20:1947620-1947642 GCTGATGGAGGGCCTCGAGCTGG + Intergenic
1169836922 20:9890658-9890680 GCTCATGCAGCACCACGAAGAGG + Intergenic
1170813361 20:19692794-19692816 GCGGACGCAGCGCCACCTGGTGG - Intronic
1172447169 20:34999335-34999357 GCTGCGGCACGGCCACGAGGAGG + Exonic
1173460252 20:43237536-43237558 GGTGGTGCAGAGCCCCGAGGTGG + Intergenic
1180837233 22:18936014-18936036 GCTGCTGGCGCGCCACGAGCAGG - Exonic
1181064729 22:20300011-20300033 GCTGCTGGCGCGCCACGAGCAGG + Intergenic
1181104299 22:20564463-20564485 GCTGCTGCAGCGCCACCTGCTGG - Exonic
1183308352 22:37096011-37096033 GCTGATGCTGAGCCCCGAGGTGG - Exonic
1183831382 22:40420034-40420056 GCTGAGGCAGTGACAGGAGGAGG - Intronic
1183931320 22:41237703-41237725 GCAGGTGCAGCGACACCAGGTGG + Exonic
1184108103 22:42380178-42380200 GTTGATGCAGCCCCACGTGGTGG - Intergenic
1185319118 22:50192413-50192435 GCTGGGGCAGCCACACGAGGGGG - Intronic
1203287326 22_KI270734v1_random:161313-161335 GCTGCTGGCGCGCCACGAGCAGG - Intergenic
949948901 3:9212999-9213021 GCTGATGCAGCTCCATGCCGGGG + Intronic
954138136 3:48591700-48591722 TCTGCTGGAGGGCCACGAGGTGG - Exonic
954300389 3:49698020-49698042 GCTGAGTTAGGGCCACGAGGTGG - Intronic
954581749 3:51706860-51706882 GGGGATTCAGCACCACGAGGCGG + Intergenic
956892256 3:73624444-73624466 GCTGCTGCGGCGCGACGTGGAGG - Exonic
966919482 3:184602452-184602474 GCAGAGGCAGCGCCAAGAGCTGG - Intronic
969490182 4:7495226-7495248 GTTGATGCAGCTCCAAGGGGAGG - Intronic
984006926 4:174323307-174323329 GCTGATGCAGAAACATGAGGGGG - Intronic
997303479 5:132823083-132823105 GCTCCTGCAGCGGCAGGAGGAGG - Exonic
998040328 5:138947332-138947354 GCTCGGGCAGCGCCAGGAGGTGG + Exonic
999141281 5:149364037-149364059 GCTGAGGCACCGGCGCGAGGTGG + Exonic
1003524587 6:6887036-6887058 GCTGAAGGAGCCCCACCAGGTGG - Intergenic
1008276826 6:49551640-49551662 GCTGGTGCAGCGCTTCGGGGAGG + Exonic
1011099711 6:83708438-83708460 GCTGCAGCAGCGCGAGGAGGAGG - Intronic
1015127105 6:129767366-129767388 GCTGAAGCGTGGCCACGAGGAGG + Intergenic
1018262153 6:161980811-161980833 ACTGCTGCACCACCACGAGGTGG + Intronic
1019648105 7:2141687-2141709 GCTGAGGAGGCCCCACGAGGAGG + Intronic
1019768977 7:2871422-2871444 GCTTATGCAGGGCCCCGAGGTGG + Intergenic
1019886464 7:3910120-3910142 GCTGACGCAGCACCACGCAGGGG - Intronic
1023382587 7:39623578-39623600 GCTGCTGCAGAGCCGCCAGGAGG + Exonic
1023989469 7:45119485-45119507 GCTGAGGGGGCGCCACAAGGAGG - Intergenic
1028534826 7:91880792-91880814 GCTGAAGTACCGCCACGAGGGGG - Intergenic
1044934399 8:97278937-97278959 GCTTCTGCAGTGCCACGTGGAGG - Intergenic
1049737993 8:144220217-144220239 GCTGAGTCAGCGCCTGGAGGGGG + Intronic
1049774443 8:144397968-144397990 GCTTGTGCAGCGCCAGGCGGTGG + Exonic
1056122775 9:83505666-83505688 GCTCAGGCAGCACCACGAGCAGG - Intronic
1062631282 9:137464259-137464281 GCTGACCCAGGGCCAAGAGGTGG + Intronic
1200212388 X:154352494-154352516 GCTCAAGCAGCCCCAAGAGGAGG - Intronic