ID: 1142436589

View in Genome Browser
Species Human (GRCh38)
Location 16:90062871-90062893
Sequence ATGTACTAGTTGACATGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 86}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142436585_1142436589 25 Left 1142436585 16:90062823-90062845 CCTGGACATACAACACTAAGAAA No data
Right 1142436589 16:90062871-90062893 ATGTACTAGTTGACATGTGATGG 0: 1
1: 0
2: 3
3: 10
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142436589 Original CRISPR ATGTACTAGTTGACATGTGA TGG Intronic
905530172 1:38672008-38672030 CTGAACAAGCTGACATGTGAGGG - Intergenic
909553536 1:76927165-76927187 ATGTACTAGGTGTTATTTGAAGG - Intronic
910246288 1:85142090-85142112 ATGTACTAGTTCATTTGTGGGGG + Intergenic
916295474 1:163214428-163214450 ATGTAGTAATAGAAATGTGAAGG - Intronic
924816898 1:247450470-247450492 TTGTACTAGTTTACATTTCATGG + Intergenic
1063756311 10:9013492-9013514 ATTTACTAGTTGACTTATGTAGG + Intergenic
1066655014 10:37689478-37689500 ATGTAATTATTGACATGTTAGGG - Intergenic
1073996433 10:109320757-109320779 ATGTAATAATTGACATGTTAAGG + Intergenic
1074636259 10:115321347-115321369 AGTTACTATTTGATATGTGAGGG + Intronic
1080678031 11:34446005-34446027 ATTTACTAGATGAAATGAGAGGG - Intronic
1083060247 11:59862356-59862378 AAGTACTACTTTACATATGATGG - Intronic
1085067935 11:73514877-73514899 ATGTAGTAGTGTACAGGTGATGG - Intronic
1085816136 11:79739205-79739227 ATGAACTAGATGAAATGAGAAGG - Intergenic
1085853792 11:80152761-80152783 ATGAAATAGTTGAGATGTGGTGG - Intergenic
1089651752 11:119919096-119919118 AAGCCCTTGTTGACATGTGATGG - Intergenic
1090107016 11:123864593-123864615 ATGACTTACTTGACATGTGATGG - Intergenic
1099146863 12:79057580-79057602 ATTTACTATTTGAGCTGTGAAGG + Intronic
1102273935 12:111565180-111565202 TTTTACTAGTGTACATGTGATGG + Intronic
1103020248 12:117528236-117528258 ATGTGACATTTGACATGTGATGG + Intronic
1106923637 13:34590360-34590382 ATCTACTAGGTGAGAGGTGATGG - Intergenic
1107805042 13:44145775-44145797 ATGTATTACTTGAAATGTTATGG + Intronic
1110137958 13:72091467-72091489 ATGAAGTAGTGGAAATGTGAAGG - Intergenic
1111689290 13:91541435-91541457 ATATACTAGGTTTCATGTGAGGG + Intronic
1113252614 13:108471212-108471234 ATGTACTAGTTGAAATGGTTTGG + Intergenic
1114506212 14:23216437-23216459 ATGTACTTATTGATATGTTAGGG - Intronic
1117591811 14:57277685-57277707 ACCTACTATTTGACATGTGTGGG - Intronic
1121267479 14:92613793-92613815 AGGTTCTAGTTTCCATGTGATGG - Intronic
1123786866 15:23683367-23683389 AGGTAAAAGTTGACATGTTATGG + Intergenic
1125033494 15:35096631-35096653 ATGCATTAGATGGCATGTGATGG + Intergenic
1126509890 15:49458286-49458308 ATGTACTATTTGGCACGTGGGGG - Intronic
1126627891 15:50703171-50703193 ATGTACTGGCTGAGATGGGAGGG - Exonic
1142436589 16:90062871-90062893 ATGTACTAGTTGACATGTGATGG + Intronic
1142524964 17:533672-533694 ATGAACTAGGTTAGATGTGAGGG - Intronic
1147481086 17:40763647-40763669 ATGTACTAGGTAACATGTAAGGG + Intergenic
1148517883 17:48238776-48238798 ATATAATAGTAGTCATGTGATGG - Intronic
1149233287 17:54561499-54561521 ATGTTCTGGTTGACATGTTTTGG + Intergenic
1159285947 18:66351892-66351914 CTGTACTAGCTGAAATATGAGGG + Intergenic
927070856 2:19528139-19528161 AAGTGCAAGTTGACATCTGAGGG + Intergenic
927351623 2:22123739-22123761 ATGTACCAGCAGACAGGTGAAGG - Intergenic
929376434 2:41291634-41291656 ATGTAATAGTTAACATGTGAGGG + Intergenic
929586509 2:43118930-43118952 ATGTCCCAGTTTCCATGTGAAGG + Intergenic
930519079 2:52440508-52440530 ATGAACTAGTGGACATGTGTTGG - Intergenic
931100986 2:59000856-59000878 ATGCACTATTTGATAAGTGATGG - Intergenic
936001944 2:108841732-108841754 ATGTACTTATTGATATGTTAGGG + Intronic
1170379140 20:15737256-15737278 AAACACTAGTTGGCATGTGAGGG + Intronic
1173895399 20:46546826-46546848 GTGAACTAGTTGGCCTGTGAGGG + Intronic
1174199176 20:48794971-48794993 CAATAATAGTTGACATGTGAGGG - Intronic
1174720228 20:52803747-52803769 ATATACTCGTTGGCATGTCATGG - Intergenic
1180741589 22:18056926-18056948 CTGTACTAGTTTCCCTGTGATGG - Intergenic
952093754 3:29923305-29923327 ATGTGCTAGTTTATCTGTGATGG - Intronic
958122393 3:89308228-89308250 ATGTACTACTTTTCATGTGTAGG - Intronic
962450512 3:135512473-135512495 ATGTACAATTTGATAAGTGAGGG - Intergenic
962635665 3:137328950-137328972 ATGAATTAGTTGACATGTGAAGG - Intergenic
967815537 3:193795388-193795410 AAATACTTGTTGAGATGTGATGG - Intergenic
968015891 3:195332415-195332437 ATGTTATAGTTTGCATGTGAAGG - Intronic
970643877 4:18097434-18097456 AGGTTCTAGCTTACATGTGAAGG - Intergenic
977866866 4:102039214-102039236 ATGTACCCGTTGAAATGTAATGG + Intronic
978969441 4:114784980-114785002 AAGTTCTAGTTTACATCTGAGGG + Intergenic
979563290 4:122124224-122124246 ATGTACTAATGGAAATGTTAGGG - Intergenic
984233362 4:177127222-177127244 ATGTACAAATTAACATTTGAGGG - Intergenic
986267792 5:6205205-6205227 ATGTAGTAGGTGACATGAGCAGG + Intergenic
987684066 5:21174037-21174059 AAGTGTTAATTGACATGTGATGG - Intergenic
987864443 5:23521910-23521932 ACAAACTAGTAGACATGTGATGG - Intronic
991556400 5:67899696-67899718 AAGTTCTTGTTGACAAGTGATGG - Intergenic
992466202 5:77007874-77007896 ATGTACATGTTGTCATTTGATGG - Intergenic
993890524 5:93466720-93466742 ATGTTCTTTTTGACATGTAAAGG - Intergenic
994457210 5:100025930-100025952 ATGTTCTAAATTACATGTGATGG + Intergenic
996819592 5:127611849-127611871 ATGTCCTAGTGGAGATGTGAAGG + Intergenic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
999811129 5:155128268-155128290 ATGAAATAGCTGACAGGTGAAGG + Intergenic
1008709831 6:54211438-54211460 ATGTAGTTTTTGACATGGGAAGG - Intronic
1008929488 6:56923660-56923682 ATGTTCCAGTTGAAATCTGAAGG + Intronic
1012004648 6:93697440-93697462 TTGTAGTAGTTGACATAGGAAGG + Intergenic
1019582493 7:1772563-1772585 ATGTTCCAGTGGACATGAGAGGG + Intergenic
1022703999 7:32786353-32786375 ATGTACTAGTTGACAGGCAAAGG - Intergenic
1022908237 7:34876481-34876503 ATGTACTAGTTGACAGGCAAAGG - Intronic
1026293237 7:69027886-69027908 ATGGACAAGTTCACATGAGATGG + Intergenic
1026346504 7:69478971-69478993 ATTTACAGGATGACATGTGATGG + Intergenic
1028257276 7:88614925-88614947 ATGTACTAGCGGTCATGTGGAGG + Intergenic
1030582742 7:111380189-111380211 ATTTATTAGTTGTCATATGAAGG + Intronic
1033728532 7:144147617-144147639 TTGGACAAGTTGACATGTGAAGG + Intergenic
1033921969 7:146404836-146404858 AAGTTTGAGTTGACATGTGAAGG - Intronic
1039121181 8:34148413-34148435 ATGTAATTGTTGACTTGTTAGGG - Intergenic
1046952769 8:120033903-120033925 ATGTACTGGTAGACAAATGAAGG + Intronic
1048057024 8:130877018-130877040 TTGTACTATTTGACAGGTAAGGG - Intronic
1050719847 9:8575430-8575452 ATGTACTAATTCATATGTGCTGG + Intronic
1056374923 9:85998308-85998330 ATGTATTTGTTGACATGAAAAGG - Intronic
1059296228 9:113273587-113273609 ATGTCTTAGTTGACTTCTGAAGG + Intronic
1187413357 X:19070343-19070365 ATGTACCAGATGAGATGTGAGGG + Intronic
1188596205 X:31904165-31904187 ATGTACTTTTTGAAATATGAAGG + Intronic
1188968214 X:36580680-36580702 ATGTTCAAGTTAACATGAGATGG - Intergenic
1189225803 X:39412292-39412314 TTGTACCAGTTTACCTGTGAGGG + Intergenic
1191583797 X:62796365-62796387 ATGTACAAGTGGACATTTCAAGG - Intergenic
1192881879 X:75293961-75293983 ATGTACTATTTCACATGTGAAGG - Intronic
1193033090 X:76920975-76920997 ATGTCCTAGTTGTCAGGTGAAGG - Intergenic
1193223649 X:78956363-78956385 ATGTACTAGTTGATATATCAAGG + Intronic
1194485533 X:94481218-94481240 TTGTACTAGCTGGCATGAGATGG + Intergenic
1195594273 X:106670512-106670534 AGGTAATATTTGAAATGTGAAGG + Intronic
1196253787 X:113492342-113492364 ATTTCCTAGTTGCCATGAGAGGG - Intergenic
1201713006 Y:17012888-17012910 ATATACTGGTTGACAGGTCATGG + Intergenic