ID: 1142440713

View in Genome Browser
Species Human (GRCh38)
Location 16:90095791-90095813
Sequence ACGGTGGCTGCCATTTTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142440706_1142440713 -4 Left 1142440706 16:90095772-90095794 CCGTCATGGCCGCTACCTAACGG No data
Right 1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG No data
1142440703_1142440713 -1 Left 1142440703 16:90095769-90095791 CCCCCGTCATGGCCGCTACCTAA No data
Right 1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG No data
1142440704_1142440713 -2 Left 1142440704 16:90095770-90095792 CCCCGTCATGGCCGCTACCTAAC No data
Right 1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG No data
1142440705_1142440713 -3 Left 1142440705 16:90095771-90095793 CCCGTCATGGCCGCTACCTAACG No data
Right 1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG No data
1142440702_1142440713 6 Left 1142440702 16:90095762-90095784 CCTGTGACCCCCGTCATGGCCGC No data
Right 1142440713 16:90095791-90095813 ACGGTGGCTGCCATTTTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142440713 Original CRISPR ACGGTGGCTGCCATTTTCAG GGG Intergenic
No off target data available for this crispr