ID: 1142442477

View in Genome Browser
Species Human (GRCh38)
Location 16:90108179-90108201
Sequence ATTCAGTGGAAGGCTGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142442477_1142442480 -7 Left 1142442477 16:90108179-90108201 CCTTCATCAGCCTTCCACTGAAT No data
Right 1142442480 16:90108195-90108217 ACTGAATACACAATTTAGTCTGG 0: 41
1: 63
2: 47
3: 40
4: 372
1142442477_1142442482 28 Left 1142442477 16:90108179-90108201 CCTTCATCAGCCTTCCACTGAAT No data
Right 1142442482 16:90108230-90108252 GCATTTTTACATAAATAATAGGG No data
1142442477_1142442481 27 Left 1142442477 16:90108179-90108201 CCTTCATCAGCCTTCCACTGAAT No data
Right 1142442481 16:90108229-90108251 TGCATTTTTACATAAATAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142442477 Original CRISPR ATTCAGTGGAAGGCTGATGA AGG (reversed) Intergenic
No off target data available for this crispr