ID: 1142443245

View in Genome Browser
Species Human (GRCh38)
Location 16:90115753-90115775
Sequence TATAGATAGCAGGCCAGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142443245_1142443251 28 Left 1142443245 16:90115753-90115775 CCACACCTGGCCTGCTATCTATA No data
Right 1142443251 16:90115804-90115826 ATATTTACCCAGTTTTATTTGGG No data
1142443245_1142443249 -7 Left 1142443245 16:90115753-90115775 CCACACCTGGCCTGCTATCTATA No data
Right 1142443249 16:90115769-90115791 ATCTATATATTTTCTTTGGCTGG No data
1142443245_1142443250 27 Left 1142443245 16:90115753-90115775 CCACACCTGGCCTGCTATCTATA No data
Right 1142443250 16:90115803-90115825 GATATTTACCCAGTTTTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142443245 Original CRISPR TATAGATAGCAGGCCAGGTG TGG (reversed) Intergenic
No off target data available for this crispr