ID: 1142464143

View in Genome Browser
Species Human (GRCh38)
Location 17:119040-119062
Sequence ATATTTACCCAGTTTTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142464143_1142464148 23 Left 1142464143 17:119040-119062 CCCACATAAAACTGGGTAAATAT No data
Right 1142464148 17:119086-119108 AAATATATAGATAGCAGGCCAGG No data
1142464143_1142464147 18 Left 1142464143 17:119040-119062 CCCACATAAAACTGGGTAAATAT No data
Right 1142464147 17:119081-119103 AAATAAAATATATAGATAGCAGG No data
1142464143_1142464149 28 Left 1142464143 17:119040-119062 CCCACATAAAACTGGGTAAATAT No data
Right 1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142464143 Original CRISPR ATATTTACCCAGTTTTATGT GGG (reversed) Intergenic
No off target data available for this crispr