ID: 1142464145

View in Genome Browser
Species Human (GRCh38)
Location 17:119075-119097
Sequence ATCTATATATTTTATTTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142464145_1142464153 24 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464153 17:119122-119144 GCCTATAACCCCAGCACTTTGGG 0: 329
1: 23969
2: 251186
3: 272230
4: 172405
1142464145_1142464152 23 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464152 17:119121-119143 TGCCTATAACCCCAGCACTTTGG 0: 206
1: 12486
2: 117102
3: 246504
4: 241017
1142464145_1142464155 27 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464155 17:119125-119147 TATAACCCCAGCACTTTGGGAGG 0: 442
1: 31350
2: 326056
3: 257146
4: 140482
1142464145_1142464149 -7 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG No data
1142464145_1142464150 -4 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464150 17:119094-119116 AGATAGCAGGCCAGGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142464145 Original CRISPR ATCTATATATTTTATTTGGC TGG (reversed) Intergenic
No off target data available for this crispr