ID: 1142464149

View in Genome Browser
Species Human (GRCh38)
Location 17:119091-119113
Sequence TATAGATAGCAGGCCAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142464144_1142464149 27 Left 1142464144 17:119041-119063 CCACATAAAACTGGGTAAATATC No data
Right 1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG No data
1142464143_1142464149 28 Left 1142464143 17:119040-119062 CCCACATAAAACTGGGTAAATAT No data
Right 1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG No data
1142464145_1142464149 -7 Left 1142464145 17:119075-119097 CCAGCCAAATAAAATATATAGAT No data
Right 1142464149 17:119091-119113 TATAGATAGCAGGCCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142464149 Original CRISPR TATAGATAGCAGGCCAGGTG TGG Intergenic
No off target data available for this crispr