ID: 1142465276

View in Genome Browser
Species Human (GRCh38)
Location 17:133619-133641
Sequence ATTCAGTGGAAGGCTGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142465272_1142465276 27 Left 1142465272 17:133569-133591 CCTATTATTTATGTAAAAATGCA No data
Right 1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG No data
1142465273_1142465276 -7 Left 1142465273 17:133603-133625 CCAGACTAAATTGTGTATTCAGT 0: 41
1: 63
2: 47
3: 40
4: 372
Right 1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG No data
1142465271_1142465276 28 Left 1142465271 17:133568-133590 CCCTATTATTTATGTAAAAATGC No data
Right 1142465276 17:133619-133641 ATTCAGTGGAAGGCTGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142465276 Original CRISPR ATTCAGTGGAAGGCTGATGA AGG Intergenic
No off target data available for this crispr