ID: 1142465346

View in Genome Browser
Species Human (GRCh38)
Location 17:134007-134029
Sequence CTGTGGGTTTGGGGGGAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142465332_1142465346 30 Left 1142465332 17:133954-133976 CCCTGGGGGGCGGGGGGAGGCGC No data
Right 1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG No data
1142465333_1142465346 29 Left 1142465333 17:133955-133977 CCTGGGGGGCGGGGGGAGGCGCG No data
Right 1142465346 17:134007-134029 CTGTGGGTTTGGGGGGAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142465346 Original CRISPR CTGTGGGTTTGGGGGGAGGT GGG Intergenic
No off target data available for this crispr