ID: 1142467184

View in Genome Browser
Species Human (GRCh38)
Location 17:142706-142728
Sequence CCCCTTCAGGGTCAGGGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142467184_1142467193 2 Left 1142467184 17:142706-142728 CCCTGACCCTGACCCTGAAGGGG No data
Right 1142467193 17:142731-142753 CATAGAGGAAAGAGATTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142467184 Original CRISPR CCCCTTCAGGGTCAGGGTCA GGG (reversed) Intergenic
No off target data available for this crispr