ID: 1142467600

View in Genome Browser
Species Human (GRCh38)
Location 17:145125-145147
Sequence GGCCAGGTTAGACACCTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 166}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142467589_1142467600 12 Left 1142467589 17:145090-145112 CCCCCAGAGGCTAGGGTGGGGTG 0: 1
1: 0
2: 1
3: 33
4: 248
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467581_1142467600 24 Left 1142467581 17:145078-145100 CCCTTGCCTCAGCCCCCAGAGGC 0: 1
1: 0
2: 3
3: 74
4: 969
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467593_1142467600 9 Left 1142467593 17:145093-145115 CCAGAGGCTAGGGTGGGGTGGCT 0: 1
1: 0
2: 3
3: 30
4: 368
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467582_1142467600 23 Left 1142467582 17:145079-145101 CCTTGCCTCAGCCCCCAGAGGCT 0: 1
1: 0
2: 7
3: 91
4: 1009
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467585_1142467600 18 Left 1142467585 17:145084-145106 CCTCAGCCCCCAGAGGCTAGGGT 0: 1
1: 0
2: 3
3: 25
4: 342
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467592_1142467600 10 Left 1142467592 17:145092-145114 CCCAGAGGCTAGGGTGGGGTGGC 0: 1
1: 0
2: 1
3: 21
4: 309
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166
1142467590_1142467600 11 Left 1142467590 17:145091-145113 CCCCAGAGGCTAGGGTGGGGTGG 0: 1
1: 0
2: 2
3: 47
4: 380
Right 1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG 0: 1
1: 0
2: 0
3: 10
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142467600 Original CRISPR GGCCAGGTTAGACACCTCTG GGG Intergenic
902212999 1:14917155-14917177 GGCGAGGCTAGAGACTTCTGTGG - Intronic
905193963 1:36259624-36259646 GGCCTGGTGATACACATCTGTGG + Intronic
906912776 1:49972981-49973003 GGGCAGGTTAGTAACCTCTCTGG - Intronic
907383573 1:54110890-54110912 GGCCAGGGTAGGCCTCTCTGAGG - Intronic
907508771 1:54943107-54943129 GGGCATGTTAGAAACCTTTGCGG + Intergenic
907759869 1:57347116-57347138 GGCCAGGGAAGGCACTTCTGGGG + Intronic
910669814 1:89761850-89761872 AGTCATGTTAGAGACCTCTGTGG - Intronic
912029874 1:105227651-105227673 GGGCATGTCAGAGACCTCTGTGG + Intergenic
912610087 1:111034103-111034125 GGCCATGTCAGAGACCTTTGTGG + Intergenic
913507910 1:119535104-119535126 GGCCAAATTATACACCTCTTAGG + Intergenic
920248002 1:204602751-204602773 TGGCAGGTTAGAGCCCTCTGTGG + Intergenic
1062826684 10:574692-574714 GGCCTGGATAAACACCTCTGTGG - Intronic
1062932031 10:1359875-1359897 GGCGTGTTTAGACACCGCTGAGG - Intronic
1065944790 10:30596522-30596544 GGCAGGGTTGGACACCTCAGAGG + Intergenic
1070387760 10:75941277-75941299 GGCCTCCTGAGACACCTCTGAGG + Intronic
1070527995 10:77311692-77311714 GGCCAGGTTAGACAAATCATTGG - Intronic
1071873499 10:89819253-89819275 GGGCATGTCAGACACCTTTGTGG - Intergenic
1072273971 10:93804172-93804194 CACCAGGTTACACATCTCTGAGG + Intergenic
1073458678 10:103653029-103653051 GGTCAGGAAAGACACCACTGAGG - Intronic
1073602997 10:104864966-104864988 GGCCAGGTAACACCTCTCTGGGG - Intronic
1077193033 11:1263386-1263408 GGCTAGGTTGGTCACCACTGGGG + Intergenic
1079272907 11:19005491-19005513 GGGCATGTTAGAGACCTTTGAGG + Intergenic
1080232563 11:30034364-30034386 GGGCATGTTAGAGACCTTTGTGG - Intergenic
1081714145 11:45236563-45236585 GGCCAGGAAAGACCCCTTTGAGG - Intergenic
1083335713 11:61920434-61920456 GGGGAGGTGAGACACCTCTAGGG + Intergenic
1084551386 11:69845059-69845081 TGACAGATTAGACACATCTGAGG - Intergenic
1087576200 11:99992901-99992923 AGCCAGGATAGACAGGTCTGGGG + Intronic
1089664432 11:120009193-120009215 GGCCAGATTACTCACATCTGAGG + Intergenic
1090144626 11:124308225-124308247 GGACAGGTTAGAAAACTATGTGG + Intergenic
1092293346 12:7178715-7178737 GGCCAGCCTAGCCACCTCTCTGG - Intergenic
1095807337 12:46334434-46334456 TGTCAGCTCAGACACCTCTGCGG + Intergenic
1095958264 12:47818914-47818936 GGCCAGGAGAGAGCCCTCTGGGG - Intronic
1098837665 12:75441750-75441772 GGCCATGTCAGAGACCTTTGTGG + Intergenic
1099168170 12:79333063-79333085 GGCCATTTTAGTCACATCTGGGG - Intronic
1100929171 12:99585934-99585956 GGGCATGTCAGAGACCTCTGTGG - Intronic
1104626732 12:130362831-130362853 TGCAAGGTTAGTCACCTGTGGGG + Exonic
1104775810 12:131389545-131389567 GGCCAGTGTAGACACACCTGAGG + Intergenic
1104894995 12:132159634-132159656 GGGCGGGTTGGGCACCTCTGGGG + Intergenic
1106699562 13:32214653-32214675 GGACAGCTTATCCACCTCTGGGG - Intronic
1115157986 14:30361786-30361808 GGCCAGGTAGGACACCTTGGGGG - Intergenic
1117571683 14:57055367-57055389 ACCCAGGTGAGACACCCCTGGGG + Intergenic
1120918055 14:89727483-89727505 GGTCAGGGAAGACCCCTCTGAGG - Intergenic
1121038564 14:90726751-90726773 GGCCAGGATTGCCGCCTCTGAGG - Intronic
1125766900 15:42142230-42142252 GGCCAGGATGGAGCCCTCTGTGG + Intronic
1127781392 15:62319738-62319760 GGACAGGTGGGACACCTCTGGGG - Intergenic
1129601352 15:77000374-77000396 GGCCATGGTAGACAGGTCTGGGG - Intronic
1131080506 15:89530724-89530746 GCCCTGGATAGACACCTGTGAGG + Intergenic
1133390178 16:5403926-5403948 GGCCTGGGAAGACACCTCTGGGG + Intergenic
1133543334 16:6777855-6777877 GGGCAGCTCTGACACCTCTGAGG - Intronic
1135074867 16:19384497-19384519 TGCCAGGTAAGCCACCTTTGGGG + Intergenic
1136517940 16:30779061-30779083 GGCAGGGTTCGATACCTCTGGGG - Exonic
1137238141 16:46632592-46632614 GGCTGGGTCAGAAACCTCTGTGG + Intergenic
1138373761 16:56548378-56548400 TGCCAGTGTAGACATCTCTGAGG + Intergenic
1139812825 16:69636812-69636834 GGCCATGTCAGAGACCTTTGTGG - Intronic
1142395790 16:89830511-89830533 GGCTGGGTTAGCCACCTTTGAGG - Intronic
1142467600 17:145125-145147 GGCCAGGTTAGACACCTCTGGGG + Intergenic
1142517606 17:443044-443066 CTCTAGGTTAGACTCCTCTGGGG + Exonic
1143150173 17:4802665-4802687 CGCCAGGCTGGACACCGCTGGGG + Intergenic
1144327699 17:14197524-14197546 GGGCCGGTCAGACACCTATGTGG - Intronic
1146121197 17:30196881-30196903 GGCCAGGGTAGACAATGCTGGGG + Exonic
1147186712 17:38716976-38716998 GGGCAGGTTAGTGACCCCTGGGG + Exonic
1147334303 17:39717382-39717404 GGTCAGGTTTCACACCGCTGGGG - Exonic
1147981196 17:44275234-44275256 GGCCAGGTGAGAGACTCCTGGGG - Intergenic
1151429067 17:74050346-74050368 GGGCAGGCTGGACACCTCTTCGG - Intergenic
1152119306 17:78408496-78408518 GGCCAGGTGAGGCACCTTGGTGG + Intronic
1152466739 17:80470927-80470949 GGCCAGGTTGTACACCTCCCCGG + Exonic
1152708651 17:81859260-81859282 GGCCAGGTCAGACTCCTCCGTGG + Exonic
1153353517 18:4108762-4108784 GTACAGGTCAGACACATCTGGGG + Intronic
1154411009 18:14142395-14142417 GGGCAGGTCTGACACCTCAGAGG - Intergenic
1156458284 18:37306971-37306993 AGCCACGTTTGCCACCTCTGTGG + Intronic
1157318990 18:46619983-46620005 GGCCAGGTCAGGGAACTCTGAGG + Intronic
1158058908 18:53314903-53314925 GGCCAGGTGAGATCCCTTTGGGG + Intronic
1162796219 19:13088975-13088997 GGCCAGGGTGGGCAGCTCTGGGG + Intronic
1163035415 19:14566539-14566561 GGCCCGGCTAGAAACCTCAGTGG + Intronic
1163342719 19:16719971-16719993 GACCAATTTAGACTCCTCTGGGG - Exonic
1165775146 19:38399932-38399954 GGCCAGGTTAGACCCTCCTCAGG + Intergenic
1166660245 19:44642349-44642371 GGCCAGGACAGCCACCTCTGGGG + Intergenic
1167496184 19:49819791-49819813 AGCCAGGATAGATCCCTCTGTGG + Intronic
925010622 2:482840-482862 GGCCAGGTTGGCTACCTCTCTGG + Intergenic
925291580 2:2751734-2751756 GACCAGAGTAGAGACCTCTGTGG + Intergenic
926080513 2:9982341-9982363 GGCCAAGATAGAAACCACTGCGG - Intronic
927438264 2:23088916-23088938 GGGCATGTCAGAGACCTCTGTGG - Intergenic
928208471 2:29305048-29305070 AGCCTGGGTAGAGACCTCTGGGG + Intronic
929824189 2:45297396-45297418 TTCCAGGTTAGACCCCTCTATGG - Intergenic
934054938 2:88243761-88243783 GGCCATGTCAGAGACCTTTGAGG + Intergenic
936721348 2:115255421-115255443 GGGCATGTCAGAGACCTCTGTGG - Intronic
939740659 2:145902079-145902101 GGCCATGTCAGACACCTTTGTGG + Intergenic
941303208 2:163829117-163829139 GGCCATGTCAGAGACCTTTGTGG - Intergenic
941967216 2:171312316-171312338 GGGCATGTTAGAGACCTTTGCGG + Intergenic
946691891 2:222315459-222315481 GGCCAGGGCAGACCTCTCTGGGG + Intergenic
947875082 2:233462452-233462474 GGCCAGAATAGCTACCTCTGTGG - Exonic
948377542 2:237531339-237531361 GGCCAGGATAGAGACCTCTTGGG + Intronic
948377546 2:237531365-237531387 GGCCAGCATAGAGACCTCTCAGG + Intronic
948467677 2:238159990-238160012 GGCCGGGATAGAGAACTCTGGGG - Intronic
1168848600 20:961527-961549 GACCAGGCTACCCACCTCTGGGG + Intronic
1169381772 20:5113375-5113397 GGCCAGGCTAGAGACCGCCGTGG + Intergenic
1169978966 20:11362353-11362375 GGCTAGGTTTGAAATCTCTGGGG + Intergenic
1173159571 20:40642265-40642287 GGCCAGGGAAGGCATCTCTGAGG - Intergenic
1173756954 20:45525029-45525051 AGCCAGGGTTGAGACCTCTGAGG - Intergenic
1174897847 20:54469625-54469647 GGCCAGGGAAGACTTCTCTGAGG - Intergenic
1175253621 20:57624811-57624833 GGCCAGGGCAGACTCCTCTAGGG - Intergenic
1175296124 20:57909941-57909963 GGGCAGGTTATCCACCTCTCTGG + Intergenic
1176862044 21:14016020-14016042 GGGCAGGTCTGACACCTCAGAGG + Intergenic
1177111162 21:17031131-17031153 GGCAAGGTTAGTGTCCTCTGAGG + Intergenic
1181632213 22:24157185-24157207 GGCCAGGTTGAACACCCCTAGGG - Intronic
1181863938 22:25840545-25840567 GGCGAGGCTGGTCACCTCTGTGG + Intronic
1182529379 22:30943623-30943645 GGCCAGGCTAAGCACCTCAGGGG + Intronic
1185253962 22:49821756-49821778 GGGCAGGTCTGACACCTCAGAGG + Intronic
958600302 3:96288686-96288708 GGGCATGTTAGAGACCTTTGAGG + Intergenic
959268000 3:104168060-104168082 GGGCATGTCAGAGACCTCTGCGG - Intergenic
961067852 3:123891223-123891245 GGCCATGTCAGAGACCTTTGTGG - Intergenic
962572702 3:136727025-136727047 GGCCAGGAAAGGCATCTCTGAGG - Intronic
966841799 3:184095555-184095577 GGACAGATTAGACACAGCTGAGG + Intergenic
968380700 4:93369-93391 GGGCATGTTAGAGACCTTTGTGG - Intergenic
968433806 4:575136-575158 GGCCAGGTCCGACTCCTCCGGGG + Intergenic
969920092 4:10530214-10530236 GGCCAAGTTTGCCACCTCTCCGG + Intronic
971857153 4:32058386-32058408 GGACATGTCAGAAACCTCTGTGG - Intergenic
973107727 4:46361195-46361217 GGGCATGTAAGAGACCTCTGTGG + Intronic
974666597 4:64969800-64969822 GGGCATGTTAGAGACCTTTGTGG - Intergenic
975228944 4:71908134-71908156 AGCCTGAATAGACACCTCTGTGG - Intergenic
975820333 4:78264645-78264667 GGGCAAGTTACACACCTCTCTGG + Intronic
976659717 4:87527253-87527275 GGCCTGGTTGGACATCTCTCAGG + Intronic
976765584 4:88594040-88594062 GGACAGGTTAGAAACCTCTTTGG + Intronic
978904003 4:113985232-113985254 GGGCATGTCAGAGACCTCTGTGG + Intergenic
980971037 4:139567424-139567446 GGCCAGGGAAGACATCTTTGAGG - Intronic
984710437 4:182879934-182879956 GGCCAGGGTGGGCCCCTCTGAGG + Intergenic
986258758 5:6124175-6124197 GGGCAAGTTAGAGACCTTTGTGG - Intergenic
990186939 5:53219813-53219835 GCCCAGGTTATTCCCCTCTGGGG - Intergenic
991441443 5:66654175-66654197 GGCCAGGGGAGACTCCTCTGAGG + Intronic
993225872 5:85166981-85167003 GGGCAGGTCAGAGACCTTTGTGG + Intergenic
993890085 5:93463073-93463095 GGCCATGTCAGAGACCTTTGCGG + Intergenic
994878092 5:105450992-105451014 GGGCATGTTAGAGACCTTTGTGG + Intergenic
996702668 5:126465784-126465806 GGCCAGGGTGGACCCCTCTCTGG + Intronic
999182906 5:149682503-149682525 GGCCAGGTCAGGCTTCTCTGAGG - Intergenic
1000659450 5:163920140-163920162 GGGCATGTTAGAGACCTCTGTGG + Intergenic
1002337851 5:178492764-178492786 GCCCAGGCCAGACACCTCTCAGG - Intronic
1003121077 6:3319399-3319421 GGTCAGGAGAGACCCCTCTGAGG - Intronic
1005118195 6:22361833-22361855 GGCCAGGTTAGACAGCTGGATGG - Intergenic
1005941863 6:30566501-30566523 GGCTAGGATAGACCTCTCTGAGG + Intergenic
1007794745 6:44338474-44338496 GGCCATGTTAGTCAGTTCTGAGG + Intronic
1008248501 6:49207932-49207954 GGGCATGTCAGAGACCTCTGCGG - Intergenic
1009684990 6:66945251-66945273 GGCCAGGCCACACACCCCTGGGG - Intergenic
1011349058 6:86402236-86402258 GGGCATGTCAGACACCTTTGTGG - Intergenic
1015773106 6:136789084-136789106 GGCCAGGTTTGAGACCTGTCTGG + Intronic
1017622135 6:156309950-156309972 GGTCAGGAAAGACATCTCTGAGG - Intergenic
1021055500 7:16042142-16042164 GCCCAGCTTATACACCTCAGGGG + Intergenic
1022102115 7:27174829-27174851 GGCCAGGTTCGCCACTTTTGAGG - Intronic
1022791786 7:33696363-33696385 GCCCATGTTAGGCATCTCTGGGG - Intergenic
1023650568 7:42364636-42364658 GGGCATGTTAGAGACCTTTGTGG - Intergenic
1023872892 7:44272259-44272281 GGCCAGGTCAGGATCCTCTGAGG + Intronic
1026984145 7:74544580-74544602 GGCCAGGGTAGGCACCTGTATGG + Intronic
1028133684 7:87205228-87205250 GGCCATGTCAGAGACCTTTGAGG - Intronic
1030108540 7:106007245-106007267 GGGCATGTCAGAGACCTCTGTGG - Intronic
1032240548 7:130155505-130155527 GGCCTGTGAAGACACCTCTGTGG - Intergenic
1034448328 7:151124633-151124655 GGCCACGTGAGCCTCCTCTGTGG - Intronic
1034908198 7:154969788-154969810 GGCCAGCTAAGACACCACCGGGG + Intronic
1035727998 8:1836442-1836464 GTCCAGGTGAGTCACCTGTGGGG + Intronic
1035737076 8:1896910-1896932 TGCCAGGTCAGAGACCCCTGAGG - Intronic
1038247341 8:25871065-25871087 GGCCGGGTTTGACAACTCTTTGG + Intronic
1044425680 8:92047173-92047195 GGCCAGGTTAGACTGGTATGAGG - Intronic
1045210996 8:100099570-100099592 GGCCATATTAGACACTACTGGGG - Intronic
1050504011 9:6328604-6328626 TGCCAGGACAGAGACCTCTGTGG + Exonic
1054267150 9:62929030-62929052 GGCCAAGTGTGTCACCTCTGAGG + Intergenic
1054550639 9:66598475-66598497 GGCCACGTGTGTCACCTCTGAGG + Intergenic
1055141936 9:72886505-72886527 GGGCATGTTAGAGACCTTTGTGG + Intergenic
1056560862 9:87727902-87727924 GGGAAGGCTTGACACCTCTGGGG - Intronic
1058446639 9:105060950-105060972 GGCCAGTGGAGACTCCTCTGGGG - Intergenic
1060058457 9:120437067-120437089 GTCCAGTTTAGACGCCTCAGGGG - Intronic
1061918691 9:133770322-133770344 GGCCAGGGCAGACCCCTCCGAGG + Intronic
1062392881 9:136340955-136340977 GGCCAGGTCAGGCTTCTCTGAGG - Exonic
1186729925 X:12398910-12398932 GGCTAGTTTAGACATATCTGTGG + Intronic
1188957779 X:36454125-36454147 GGCCAGGGCAGGCAACTCTGTGG - Intergenic
1189019398 X:37318862-37318884 GGCCAGCTTGGACACTTCTCTGG + Intergenic
1189561619 X:42196650-42196672 TGCCAGGGTAGACACCAGTGTGG + Intergenic
1193210456 X:78801633-78801655 GGGCATGTCAGACACCTTTGTGG + Intergenic
1194971684 X:100351134-100351156 GGCAAGGTAATACACCACTGTGG + Intronic
1202015542 Y:20402359-20402381 GGCCATGTCAGAGACCACTGTGG - Intergenic