ID: 1142468671

View in Genome Browser
Species Human (GRCh38)
Location 17:149906-149928
Sequence GGTGATGGATGTACAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 15, 3: 48, 4: 276}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142468671_1142468678 5 Left 1142468671 17:149906-149928 CCCAGAGTTGTACATCCATCACC 0: 1
1: 0
2: 15
3: 48
4: 276
Right 1142468678 17:149934-149956 CTCCATTGGAGCTTTGAGGAAGG 0: 1
1: 0
2: 1
3: 10
4: 161
1142468671_1142468673 -9 Left 1142468671 17:149906-149928 CCCAGAGTTGTACATCCATCACC 0: 1
1: 0
2: 15
3: 48
4: 276
Right 1142468673 17:149920-149942 TCCATCACCACTACCTCCATTGG 0: 1
1: 0
2: 0
3: 38
4: 182
1142468671_1142468676 1 Left 1142468671 17:149906-149928 CCCAGAGTTGTACATCCATCACC 0: 1
1: 0
2: 15
3: 48
4: 276
Right 1142468676 17:149930-149952 CTACCTCCATTGGAGCTTTGAGG 0: 1
1: 0
2: 1
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142468671 Original CRISPR GGTGATGGATGTACAACTCT GGG (reversed) Intronic
901335317 1:8444068-8444090 GCTGATGGATCTACCATTCTTGG - Intronic
901488332 1:9581199-9581221 AGTGACGAATGTCCAACTCTAGG + Intronic
903753573 1:25645408-25645430 GGCGATGGAGGAACCACTCTGGG - Intronic
904358231 1:29955212-29955234 TGGGATGGATGGACAACCCTGGG + Intergenic
904942016 1:34170592-34170614 GCTGGTGGATGGGCAACTCTAGG + Intronic
905787883 1:40772357-40772379 GGTCTTGGCTGTAGAACTCTTGG - Intergenic
906107180 1:43301509-43301531 GGTGATGGTGGGACAACACTAGG + Intronic
906849425 1:49232152-49232174 AGTGATGGTTGCACAACTCTGGG + Intronic
909719853 1:78754921-78754943 GTTGGTGGATCTACAATTCTGGG - Intergenic
909870840 1:80736265-80736287 TGTGCTGGATGTAATACTCTAGG - Intergenic
910055872 1:83032448-83032470 GTTGATGGATCTACCATTCTGGG - Intergenic
910141465 1:84031539-84031561 GCCAATGGATGTACCACTCTGGG + Intergenic
910514266 1:88040506-88040528 AGTGCTGGATATAGAACTCTTGG - Intergenic
911225728 1:95303759-95303781 GGTGATGGTTGCACAACAATGGG - Intergenic
911985440 1:104616595-104616617 GTTGATGGATCTATCACTCTGGG + Intergenic
913350688 1:117855406-117855428 GGTGATGGTTATACAACTCTTGG + Intergenic
913639784 1:120801366-120801388 GGTGATGGTTGCAGAACTTTTGG + Intergenic
913704695 1:121407735-121407757 GGTGATGGTTGTACAACTTTGGG - Intergenic
914212716 1:145595162-145595184 GGTGATGGTTGCAGAACTTTTGG - Intergenic
914278693 1:146148975-146148997 GGTGATGGTTGCAGAACTTTTGG - Intronic
914539740 1:148599917-148599939 GGTGATGGTTGCAGAACTTTTGG - Intronic
914626934 1:149471701-149471723 GGTGATGGTTGCAGAACTTTTGG + Intergenic
917290884 1:173471221-173471243 GTTGGTGGATCTACCACTCTGGG - Intergenic
917781032 1:178397550-178397572 GGTGATGGTTGCACAGCTTTGGG + Intronic
918077008 1:181178108-181178130 GGTGATGGTTGTCTAACACTGGG + Intergenic
918123585 1:181561157-181561179 AGTGATGGTTGTACAACAATAGG + Intronic
919291890 1:195643477-195643499 GTTGATGGAGCTACCACTCTGGG + Intergenic
920797097 1:209149731-209149753 GGTTAGCGTTGTACAACTCTGGG + Intergenic
922917048 1:229267143-229267165 GGTGATGGTTGCACAACAATGGG + Intergenic
1062777650 10:167158-167180 GGTGATGGTTGCAAAACACTGGG + Intronic
1065249789 10:23799074-23799096 GGTGATGCATGTACAAGCCAAGG - Intronic
1065250905 10:23812593-23812615 GGTGATGGTTGCACAACTCTGGG - Intronic
1065933608 10:30500679-30500701 GGTGGTGGATGAAAAACACTAGG - Intergenic
1067966872 10:50923257-50923279 GTTGATGGATCTACCATTCTTGG + Intergenic
1069799018 10:71070833-71070855 TGTGATGGATGCTCAGCTCTGGG - Intergenic
1069817602 10:71208501-71208523 GGTGATGGCTGCACAACATTGGG + Intergenic
1070246094 10:74732514-74732536 GGTGATGGTTGTCCAACCCAGGG - Intergenic
1070259004 10:74835296-74835318 GAGGATGGATGAACATCTCTTGG - Intronic
1071873406 10:89818804-89818826 GTTGATGGATCTACCATTCTTGG + Intergenic
1072276999 10:93833405-93833427 GCTGGTGGATGTACCATTCTGGG + Intergenic
1072496421 10:95964859-95964881 GGTGATTGTTGCACAATTCTGGG - Intronic
1072609779 10:97010484-97010506 GGTGATGGATACACAACTCTGGG + Intronic
1077899904 11:6479791-6479813 GGAAATGGATGGACAACGCTGGG + Intronic
1079872923 11:25822522-25822544 GCTGATGGATCTACCATTCTGGG - Intergenic
1080040612 11:27755845-27755867 GGTAATGGTTGTACAACAATGGG - Intergenic
1082263176 11:50093138-50093160 GGTGATTGATGCACAGCTCTGGG + Intergenic
1084401830 11:68948665-68948687 GGTGATGGTTGCACAATGCTGGG - Intergenic
1085652834 11:78283985-78284007 GGAGTTGGATATACAACTCTAGG - Intronic
1085986272 11:81792171-81792193 GTTGGTGGATATACAATTCTGGG + Intergenic
1086964517 11:93014001-93014023 GGTGGTGGTTGTACAACATTGGG - Intergenic
1087125984 11:94626133-94626155 TGTGGTGGATCTACAATTCTAGG + Intergenic
1087166857 11:95013462-95013484 GTTGATGGTTGTACAACGATGGG - Intergenic
1089133080 11:116227495-116227517 GGTAATGGTTGCATAACTCTGGG - Intergenic
1089906944 11:122049694-122049716 GGTGATGGTTGCACAACAATGGG - Intergenic
1090179708 11:124685575-124685597 GTTGGTGGATCTACCACTCTAGG - Intronic
1090741743 11:129668255-129668277 GGTGATGAGTGTCCAATTCTAGG - Intergenic
1093624282 12:21327414-21327436 GTTGATGGATCTACCATTCTGGG - Intronic
1094221055 12:27994055-27994077 GTTGATTGATGTCCATCTCTAGG - Intergenic
1095308226 12:40662891-40662913 GTTGGTGGATCTACAATTCTGGG - Intergenic
1095526692 12:43134566-43134588 TGTGATGGAAGTTCTACTCTGGG + Intergenic
1100597967 12:96087891-96087913 GTTGATGGATCTACCATTCTGGG - Intergenic
1101083803 12:101214967-101214989 GTTGGTGGATCTACAATTCTGGG - Intergenic
1101699040 12:107154404-107154426 GGTGATGGTTGCACAACAATGGG - Intergenic
1102589609 12:113947394-113947416 GGTGATGAATGCAAAACCCTTGG + Exonic
1103264624 12:119618411-119618433 GTTGATGGATCTACCATTCTGGG - Intronic
1103464834 12:121133638-121133660 GGGGATGGTTGCACAACTCTGGG - Intronic
1103652953 12:122447324-122447346 GGTGATGGCTTTACAACTCTGGG + Intergenic
1105703873 13:22956699-22956721 GGAGATGGATGAGCAACCCTTGG - Intergenic
1105936829 13:25108202-25108224 GATGGTGGTTGCACAACTCTTGG - Intergenic
1105950058 13:25222142-25222164 GGTGATGGTTGCACAACTTGTGG + Intergenic
1106006888 13:25778995-25779017 GGTGATGGTTGCACAAGGCTGGG + Intronic
1107051062 13:36050393-36050415 GCTGATGGATGTTAAATTCTTGG + Intronic
1107554730 13:41507811-41507833 GTTGGTGGATCTACCACTCTGGG + Intergenic
1108007567 13:45966651-45966673 TCTGATGGAGGTACAACCCTGGG - Intronic
1108462254 13:50678320-50678342 GTGGATGGATGTACATCTCCAGG + Intronic
1108598271 13:51968620-51968642 GGTCATGGCTGTAACACTCTGGG + Intronic
1109482416 13:62973639-62973661 GTTGATGGATCTACCATTCTGGG + Intergenic
1109521109 13:63511853-63511875 GGTGATAGAGGTACAGGTCTGGG - Intergenic
1109990230 13:70045135-70045157 GGTGATGGATGTATAAGTCAAGG - Intronic
1110377903 13:74814748-74814770 GTTGGTGGATCTACCACTCTAGG - Intergenic
1112611519 13:100959688-100959710 ACTGTTGGATGTACAAGTCTGGG - Intergenic
1112971741 13:105270433-105270455 GTTGATGGATCTACTATTCTGGG - Intergenic
1113029349 13:105976504-105976526 GTTGGTGGATCTACAATTCTGGG + Intergenic
1113061072 13:106323217-106323239 GGTGGTGGATCTACCATTCTGGG - Intergenic
1114957470 14:27841933-27841955 GGTGATGCATGCACAAGTCAAGG - Intergenic
1117621985 14:57596879-57596901 TGTCATGGATGAACTACTCTTGG - Exonic
1118382242 14:65226989-65227011 GGAGAAGGATCTAAAACTCTGGG + Intergenic
1120091090 14:80334100-80334122 GTCGATGGATGTACCATTCTGGG + Intronic
1122845589 14:104496027-104496049 GGAGATGGATGAGCAACCCTTGG - Intronic
1123505055 15:20933623-20933645 GGTAATGGTTGCACAACTCTGGG + Intergenic
1123562300 15:21507318-21507340 GGTAATGGTTGCACGACTCTGGG + Intergenic
1123598545 15:21944605-21944627 GGTAATGGTTGCACAACTCTGGG + Intergenic
1123826969 15:24092187-24092209 GTTGGTGGATATACCACTCTGGG + Intergenic
1123841571 15:24253051-24253073 GTTGGTGGATATACCACTCTGGG + Intergenic
1123851457 15:24361648-24361670 GTTGGTGGATATACCACTCTGGG + Intergenic
1123856356 15:24416020-24416042 GTTGGTGGATATACCACTCTGGG + Intergenic
1124114577 15:26829425-26829447 GCTGATGGATGTATAACCCTAGG - Intronic
1124547940 15:30649987-30650009 GGTGATGGTTATACAACAATGGG - Intronic
1125997846 15:44181567-44181589 GGTGAGGGTTGCACAACTCTGGG - Intronic
1126117140 15:45218565-45218587 TGTGATAGATGTAAAGCTCTTGG - Intergenic
1127209101 15:56753219-56753241 GGTGATGGTTGCACAACAATGGG + Intronic
1127576212 15:60295041-60295063 GTTGATGGATCTACCATTCTGGG + Intergenic
1128904860 15:71457729-71457751 GGTGGTGGAGGGACAAGTCTTGG - Intronic
1129083624 15:73065465-73065487 GGTGCTGGATGTAGAATTCTAGG + Intronic
1129815900 15:78553956-78553978 GGTGATGGTCGCACAACCCTGGG - Intergenic
1131593010 15:93769359-93769381 GGTGCAGTAGGTACAACTCTGGG + Intergenic
1131659562 15:94499136-94499158 GTTGATGGATCTACCATTCTGGG - Intergenic
1132200697 15:99952776-99952798 GGTGATGGATGTGTATCTCCAGG - Intergenic
1132349562 15:101131108-101131130 GGTGATGGTTGCACAACAGTGGG + Intergenic
1202970645 15_KI270727v1_random:234459-234481 GGTAATGGTTGCACAACTCTGGG + Intergenic
1133017725 16:2952134-2952156 TGTGATGGATGCACAACCCTAGG - Intergenic
1133194746 16:4161053-4161075 GGTGATGGCTATACAATTCTAGG - Intergenic
1133618171 16:7499252-7499274 GGTGATGCTTCTACAACTCAAGG - Intronic
1133968680 16:10551056-10551078 GGTGATGGATATACAATATTGGG - Intronic
1135626986 16:24004236-24004258 GATGAGCAATGTACAACTCTTGG + Intronic
1136751875 16:32644568-32644590 GGAGAAGGATGTAGAATTCTTGG + Intergenic
1137658657 16:50183961-50183983 GGTGATGGTTGCACAACTCTAGG - Intronic
1138649738 16:58452908-58452930 GGTTAAGGATGTGCCACTCTTGG + Intergenic
1139477542 16:67210174-67210196 GATGCAGGATGTACAGCTCTGGG - Exonic
1141164866 16:81653565-81653587 GGTGCTGGATGTCCAGCTCCAGG + Intronic
1142322205 16:89390771-89390793 GGTAATGGTTGTCTAACTCTGGG + Intronic
1203054012 16_KI270728v1_random:903822-903844 GGAGAAGGATGTAGAATTCTTGG + Intergenic
1142468671 17:149906-149928 GGTGATGGATGTACAACTCTGGG - Intronic
1143754911 17:9059733-9059755 GGTGATGGTTGTACAGCTTTGGG + Intronic
1144463121 17:15474144-15474166 GATCATGGATGTAAAACTCTTGG - Intronic
1145122228 17:20270190-20270212 GGTGATGGTTGCACAACATTGGG + Intronic
1146919888 17:36703460-36703482 GGAGAGGGATGTATAACACTTGG + Intergenic
1147845395 17:43400823-43400845 GGTCATGGATCTACAAATGTGGG - Exonic
1148910422 17:50939632-50939654 GGCAATGGATGTACACCTGTGGG + Intergenic
1149480191 17:56997199-56997221 AGTGATGACTGCACAACTCTGGG - Intronic
1150189493 17:63223182-63223204 GGTGATGGTTGCACAACATTGGG + Intronic
1152199924 17:78939403-78939425 GGAGAGGGATGGACAGCTCTTGG + Intergenic
1153503859 18:5774990-5775012 GGTGATGGATGCACAGCTCTTGG - Intergenic
1153685233 18:7538529-7538551 GTTGAGGGATCTACAATTCTGGG + Intergenic
1157594595 18:48856829-48856851 GGTGATGGTTGCACAATTCTGGG + Intronic
1160896378 19:1404054-1404076 GGTGATGGTTGCACAACAATGGG + Intergenic
1162498461 19:11036707-11036729 GGTGAGAGATGCACAACTCTTGG - Intronic
1165437641 19:35805155-35805177 GGTGATGGTTGCACAATTTTGGG + Intronic
1165931292 19:39360975-39360997 AGAGCTGGATCTACAACTCTTGG - Intronic
1168518878 19:57032718-57032740 GGTGATGGCTGCACAACAATGGG - Intergenic
925122544 2:1430558-1430580 GCTGGTGGATCTACAATTCTGGG - Intronic
925163575 2:1703151-1703173 GGTGAAGGAGGGACAACTCCAGG + Intronic
925163647 2:1703389-1703411 GGTGAAGGAGGGACAACTCCAGG + Intronic
925163652 2:1703410-1703432 GGTGAAGGAGGGACAACTCCAGG + Intronic
925163934 2:1704298-1704320 GGTGAAGGAAGGACAACTCCAGG + Intronic
925778567 2:7358072-7358094 GGTGATGATTGTACAACCTTAGG - Intergenic
926266308 2:11325199-11325221 GGTAGTGGATGTGCAACTCACGG - Intronic
926952175 2:18254391-18254413 GCTGGTGGATCTACCACTCTGGG - Intronic
927859033 2:26548393-26548415 GGTGATGGGTGTACAACCTTGGG - Intronic
928731108 2:34233982-34234004 ATTGGTGGATGTACAATTCTAGG + Intergenic
930940958 2:57013808-57013830 GTTGATGGATCTACAATTCTGGG - Intergenic
930990164 2:57644821-57644843 GGTGATGGTTGCACAATTCTGGG - Intergenic
934099496 2:88639541-88639563 GGTGATGGTTGTATGACTCTAGG + Intergenic
934717720 2:96553055-96553077 GGTGGTGGATGTAGATTTCTGGG + Intergenic
934898130 2:98136300-98136322 GGTGATGGGTGTACAACAATGGG - Intronic
937471200 2:122175321-122175343 GGGGATGGATGTATCACTTTAGG + Intergenic
939417029 2:141913136-141913158 GGTGATGGTTGCACAACAGTAGG + Intronic
944200450 2:197101506-197101528 AGTGATGGTTGTACAACAGTAGG + Intronic
945495240 2:210500761-210500783 GGTGATGGATCTACCATTCTGGG + Intronic
947076352 2:226349905-226349927 GGTGATGCATCTACAACTCAAGG + Intergenic
947273173 2:228362228-228362250 GCTGGTGGATTCACAACTCTAGG - Intergenic
947505515 2:230705410-230705432 TCTGATGGATGTAGAAGTCTAGG - Intergenic
948448506 2:238052799-238052821 GGTGATGGTTGCACAACCTTGGG + Intronic
1170225371 20:13986312-13986334 GGTAATGGCTGTACAACACTGGG - Intronic
1174038696 20:47684066-47684088 GGTGATGGTTATACAACTCTGGG + Intronic
1174187278 20:48715629-48715651 GGTGATGAATGTAAAAGTCTTGG + Intronic
1174505918 20:51017526-51017548 GGTGTGGTTTGTACAACTCTGGG + Intronic
1174700471 20:52603344-52603366 GGTGATAGATGTGCAACACAGGG - Intergenic
1177455592 21:21333362-21333384 GAAGATGGCTGTACTACTCTGGG - Intronic
1177918695 21:27123882-27123904 GTTGGTGGATCTACAATTCTGGG + Intergenic
1178224450 21:30699496-30699518 GTTGGTGGATGTACTATTCTGGG + Intergenic
1178962602 21:37081004-37081026 TTTGATGGATGTACAATTGTAGG + Intronic
1179057680 21:37951319-37951341 GGTCATGGATTCACATCTCTTGG + Intergenic
1182945342 22:34316524-34316546 GTTGGTGGATATACAATTCTGGG - Intergenic
1184201940 22:42975805-42975827 GGTGATGGATATATAAGTTTTGG - Intronic
949381565 3:3451890-3451912 GGTGATGCATGCACATCACTGGG + Intergenic
950760147 3:15215409-15215431 GGGGATGACTGCACAACTCTGGG - Intronic
951420611 3:22479827-22479849 GGAGATGAATGTACAGTTCTAGG - Intergenic
951794053 3:26518094-26518116 GTTGATGGATCTACCATTCTGGG - Intergenic
952797733 3:37256988-37257010 TGTGATGAATGTACAACACTGGG - Intronic
954431918 3:50475428-50475450 AGTGATGGAGCTACGACTCTCGG - Intronic
954495135 3:50951284-50951306 GTTGATGGATGTACAAATTTGGG + Intronic
955713664 3:61805870-61805892 GGAGATGGATTTACAAATCTTGG + Intronic
955876472 3:63495048-63495070 TGTGAAGGAAGAACAACTCTAGG + Intronic
956217552 3:66864440-66864462 GAGGATGGTCGTACAACTCTGGG - Intergenic
958550547 3:95607053-95607075 GTTGGTGGATCTACCACTCTGGG + Intergenic
959202900 3:103271356-103271378 GCTGATGGATCTACCATTCTGGG + Intergenic
961302187 3:125929429-125929451 GGTTATGGACATACAACTCCTGG - Exonic
961525122 3:127491876-127491898 GGTGATGGTAGTACAACAATGGG + Intergenic
961702494 3:128757149-128757171 GGTGATGTATGTACAAGAGTGGG - Intronic
961806084 3:129490346-129490368 GGGGATGGCTGTCCATCTCTAGG - Intronic
961901151 3:130213201-130213223 TGAGATGCATGTTCAACTCTGGG - Intergenic
962843617 3:139256507-139256529 GGTGATGAATGCACAACAATGGG - Intronic
963386183 3:144598071-144598093 GTTGATAGATGTACCATTCTGGG + Intergenic
964883401 3:161450389-161450411 GGTGATGGTTGCACAGCTCGTGG - Intergenic
965049464 3:163626893-163626915 GTTGGTGGATCTACCACTCTGGG - Intergenic
965405089 3:168258173-168258195 GGGGCTGGATGTACAGATCTGGG - Intergenic
966350590 3:179029878-179029900 GGTGATGGATGCACTAAACTTGG - Intronic
967928304 3:194670735-194670757 GGTGATGGTTATCAAACTCTGGG - Intronic
968020733 3:195386308-195386330 GGTGATAGTTGTACAACACTGGG + Intronic
968353957 3:198086479-198086501 GATGCTGGTTGTACAACACTGGG + Intergenic
969414297 4:7048649-7048671 GGTGATGGCTGTACAACACTGGG - Intronic
969826969 4:9765224-9765246 GGGGATGCATGTACAGCTCCAGG + Intergenic
971739664 4:30503511-30503533 GTTGGTGGATCTACCACTCTGGG - Intergenic
971962566 4:33507820-33507842 GTTGGTGGATCTACAATTCTGGG - Intergenic
972190686 4:36587402-36587424 GTTGGTGGATCTACCACTCTGGG - Intergenic
972226897 4:37023854-37023876 GTTGATGGAAGAACAGCTCTTGG + Intergenic
972347579 4:38205734-38205756 GATGATGCATGTAAAAATCTTGG + Intergenic
972834790 4:42856861-42856883 AGTGATGTATCTACAAGTCTAGG + Intergenic
973732130 4:53832881-53832903 GTTGGTGGATCTACAATTCTAGG - Intronic
974178718 4:58358569-58358591 GTTGATGGATCTACAATTCTGGG - Intergenic
976453559 4:85219659-85219681 GGTGGTGGATCTACCATTCTGGG - Intergenic
977577185 4:98687591-98687613 GGTGATGATTGTACATATCTGGG - Intergenic
978492409 4:109323161-109323183 GTTGATGGATCTACCAGTCTGGG + Intergenic
979414330 4:120417621-120417643 GTTGATGGATATACCATTCTGGG - Intergenic
979507816 4:121518157-121518179 GATGATGGTTGCACAACTGTGGG - Intergenic
981242433 4:142493364-142493386 GGTGATGGATCTACCATTCTGGG - Intronic
982554315 4:156840627-156840649 GTTGATGGACCTACAATTCTGGG - Intronic
984117104 4:175695292-175695314 GGTGGTGGATCTACCATTCTGGG - Intronic
984757821 4:183340311-183340333 GGTGATGATTGCACAGCTCTGGG - Intergenic
985416570 4:189741542-189741564 GGTGATGGCTGCACAACAATGGG - Intergenic
986129037 5:4910214-4910236 GTTGATGGATCTACTATTCTGGG + Intergenic
987225994 5:15842065-15842087 GTTGGTGGATCTACCACTCTGGG - Intronic
988031796 5:25771997-25772019 GTTGATGGATCTACCATTCTGGG - Intergenic
988473842 5:31565465-31565487 GTTGGTGGATCTACCACTCTGGG + Intergenic
988928875 5:36016025-36016047 GCTGGTGGATCTACAATTCTGGG - Intergenic
988942335 5:36159078-36159100 GGTAATGGATGTGCAAATCTGGG + Intronic
989397507 5:40974129-40974151 GGTGATGGTTGCACAACAATGGG - Intronic
990134863 5:52632708-52632730 GGTGATGGCTGCACAACTTTTGG + Intergenic
990219400 5:53571129-53571151 GGTTTTGGTTGTACAATTCTGGG - Intronic
990315039 5:54575819-54575841 GGTGAAGGATGTAAAACTAATGG - Intergenic
990540366 5:56766445-56766467 GGTGGTGGTTGTACAACAATGGG - Intergenic
990543117 5:56794186-56794208 GGTGATGGTTGTGCAATTCTGGG - Intergenic
991992699 5:72357116-72357138 GTTGTTGGATATACAAGTCTGGG - Intronic
992711410 5:79461011-79461033 GGGTTTGGATGTAGAACTCTTGG + Intronic
992838027 5:80659312-80659334 GATGATGGTTGCACAACTCTGGG - Intronic
993481569 5:88430786-88430808 GTTGGTGGATGTACCATTCTTGG + Intergenic
994549181 5:101208873-101208895 GTTGGGGGATCTACAACTCTGGG - Intergenic
994652802 5:102550261-102550283 TGTGATGGATGTAAATCACTAGG - Intergenic
994828579 5:104747337-104747359 GTTGATGGATCTACCATTCTGGG - Intergenic
995649212 5:114348970-114348992 GGTGATGGTTATGTAACTCTGGG - Intergenic
996911424 5:128660884-128660906 GTTGGTGGATCTACAATTCTGGG - Intronic
997086514 5:130806368-130806390 GTTGATGGATGTACCATTCTGGG - Intergenic
997853038 5:137349694-137349716 GGTGATGCATCTACAAGTCAAGG - Intronic
998298714 5:140997159-140997181 TGTCATGAATGTACCACTCTGGG - Intronic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
999020804 5:148163620-148163642 GTTGGTGGATCTACAATTCTGGG + Intergenic
1001194852 5:169663351-169663373 GTTGGTGGATCTACAATTCTGGG + Intronic
1002850983 6:996106-996128 GGGGAAGGTTGCACAACTCTGGG + Intergenic
1004361831 6:14978123-14978145 GGTGATAGTTGCACAACTTTGGG - Intergenic
1005174761 6:23032115-23032137 GGTGATGGTTGCACAACATTGGG + Intergenic
1006593401 6:35174774-35174796 GGTGATAGTTGCACAACTTTGGG + Intergenic
1009545773 6:65018360-65018382 GGTGATGCATCTACAACTACGGG - Intronic
1009602420 6:65819412-65819434 GGTGATGGATATTCACCGCTTGG - Intergenic
1010087545 6:71938266-71938288 GGTGGTGGATGTACTGTTCTAGG + Intronic
1010611910 6:77963297-77963319 GTCGATGGATCTACTACTCTGGG - Intergenic
1011236893 6:85228173-85228195 GTTGATGGATCTACCATTCTGGG + Intergenic
1012142583 6:95642586-95642608 GGTGAAGTATGTAAAACTCCTGG - Intergenic
1013500190 6:110741786-110741808 GTTGTTGGATGTAGAATTCTTGG - Intronic
1014218278 6:118774190-118774212 GGTGATGGTTACACAACACTGGG + Intergenic
1014721235 6:124920590-124920612 GTTGGTGGATCTACTACTCTGGG + Intergenic
1016151546 6:140747694-140747716 GTTGGTGGATGTACCATTCTAGG - Intergenic
1017203325 6:151778317-151778339 GGTGATGGCTGCACAACACTGGG + Intronic
1018817207 6:167342593-167342615 GGTGATGGTTGCACAACACGGGG + Intronic
1021134474 7:16948703-16948725 GTTGATGGATCTACCATTCTAGG - Intergenic
1024055551 7:45657922-45657944 GGTGATGGCTGTGCACCCCTGGG + Intronic
1024213657 7:47228196-47228218 GGTGATGGCTGCACAACAGTGGG + Intergenic
1025185357 7:56853619-56853641 GGTGATCGATGTACAGCTCTGGG + Intergenic
1025686574 7:63723340-63723362 GGTGATCGATGTACAGCTCTGGG - Intergenic
1027472137 7:78586640-78586662 GGTGATGGTTGCACAACAATGGG - Intronic
1027604564 7:80284315-80284337 GTTGGTGGATCTACCACTCTGGG - Intergenic
1028011345 7:85648567-85648589 GCTGGTGGATCTACAATTCTGGG + Intergenic
1029235915 7:99118714-99118736 GGTGATGGTTGTACAACACTGGG + Intronic
1031435577 7:121728450-121728472 GTTGGTGGATCTACCACTCTGGG + Intergenic
1032503826 7:132420645-132420667 GGTGATGGTTGCACAACAATGGG - Intronic
1033251725 7:139766434-139766456 GGTGGTGAATGTACAGCACTTGG - Intronic
1034750008 7:153559833-153559855 GTTGGTGGATCTACTACTCTGGG + Intergenic
1037625440 8:20602284-20602306 GATGACGGATTTGCAACTCTGGG - Intergenic
1037683876 8:21121093-21121115 GGTGATGTATGTGCACCCCTGGG + Intergenic
1039035346 8:33353465-33353487 GGGGATGGCTGTAGAACTCCGGG - Intergenic
1039186942 8:34928092-34928114 GGTCATGGATGTAAAATACTTGG - Intergenic
1039576990 8:38631597-38631619 GGGCATGGATGAAGAACTCTGGG - Intergenic
1039701671 8:39968435-39968457 GGTGATGGATATATGGCTCTAGG + Intronic
1040731025 8:50447110-50447132 GGGGATTGCTGTACAAGTCTGGG + Intronic
1041336674 8:56793194-56793216 GGTGATGGCTGTCCAACTCTGGG + Intergenic
1041392571 8:57359919-57359941 GCTGATGGATCTACAATTCTGGG - Intergenic
1043266250 8:78270789-78270811 GTTGGTGGATCTACCACTCTGGG + Intergenic
1044688182 8:94848405-94848427 AGTGATAGCTGCACAACTCTAGG - Intronic
1045944250 8:107777549-107777571 GGTGATGGTTGCATAACTGTGGG - Intergenic
1046531939 8:115457535-115457557 GGTGATGGTTGCACAACATTAGG + Intronic
1047335354 8:123930744-123930766 GCTGGTGCATGTACAACACTGGG + Intronic
1049364045 8:142227854-142227876 GATAATGGATGTACAACACATGG + Intronic
1051789803 9:20788380-20788402 GATGATGGTTGCACAGCTCTAGG + Intronic
1052892086 9:33710935-33710957 GGTGATGAGTGTCCAATTCTAGG - Intergenic
1053030737 9:34775463-34775485 GGTGATGGTTGTACAGCAGTGGG + Intergenic
1053678023 9:40457665-40457687 GGTGATGCATGCACAAGTCAAGG - Intergenic
1053927940 9:43085695-43085717 GGTGATGCATGCACAAGTCAAGG - Intergenic
1054285711 9:63167275-63167297 GGTGATGCATGCACAAGTCAAGG + Intergenic
1054291095 9:63293202-63293224 GGTGATGCATGCACAAGTCAAGG - Intergenic
1054389112 9:64597737-64597759 GGTGATGCATGCACAAGTCAAGG - Intergenic
1054506602 9:65918633-65918655 GGTGATGCATGCACAAGTCAAGG + Intergenic
1057070744 9:92097742-92097764 GGTGATAGTTGTATAACTCTGGG + Intronic
1057525883 9:95800691-95800713 GGTGATGGGTGCCCAACTCTGGG + Intergenic
1058191844 9:101926721-101926743 GGTGATGCTTGCACAACTCTGGG - Intergenic
1058573812 9:106378521-106378543 GGTGAAGGATAGAGAACTCTGGG + Intergenic
1058834419 9:108848526-108848548 GTTGATGGATCTACCATTCTGGG + Intergenic
1059129287 9:111728742-111728764 GGTGATGATTGCACAACTCTGGG + Intronic
1059582611 9:115567742-115567764 GTTGATGGATCTACCATTCTGGG - Intergenic
1059674935 9:116529098-116529120 GTTGATGGATTTACTATTCTGGG - Intronic
1060323252 9:122585797-122585819 TGTGATGGGTGCACAATTCTGGG + Intergenic
1061045226 9:128161312-128161334 TGTGATGGATGTACAACCCTGGG - Intronic
1061948917 9:133925126-133925148 GGGGATGGTTGTACAACACTGGG + Intronic
1185808069 X:3078847-3078869 GGTGATGGTTGTACAATATTGGG - Intronic
1186501747 X:10056437-10056459 GGTGATGGCTGTACAACCTTGGG - Intronic
1186611739 X:11144389-11144411 CGTCATGGATGTACATGTCTTGG - Intronic
1186633546 X:11377480-11377502 GGTAATGGATGCACAACTAGAGG + Intronic
1187002745 X:15199526-15199548 GTCGATGGATCTACCACTCTGGG + Intergenic
1187474873 X:19601946-19601968 GATGATGGATGTAGACCACTAGG - Intronic
1187546233 X:20255406-20255428 GGTGATGGCTGCACAACCTTGGG + Intronic
1188962338 X:36507819-36507841 GTTGATGGATCTACTATTCTGGG + Intergenic
1189136682 X:38557808-38557830 GGTGATGGTTGTGCAACAGTGGG - Intronic
1190423255 X:50307574-50307596 GGTGATAGCTGTACAAATCCAGG - Intronic
1190816391 X:53933717-53933739 GATGATGAATATAGAACTCTGGG + Intergenic
1191978036 X:66895439-66895461 GGTGAAGGTTATAGAACTCTGGG - Intergenic
1193280859 X:79648832-79648854 GGTGATGAATGTTAAACTGTTGG - Intergenic
1193787354 X:85775425-85775447 GGTGATGGTTGCACAACAATGGG - Intergenic
1194034553 X:88854516-88854538 GTTGGTGGATCTACAATTCTGGG - Intergenic
1194149770 X:90309697-90309719 GTTGGTGGATGTACCATTCTGGG + Intergenic
1194150782 X:90323260-90323282 GTTGGTGGATGTACCATTCTGGG + Intergenic
1194563081 X:95447160-95447182 GTTGGTGGATCTACAATTCTGGG + Intergenic
1194944229 X:100048831-100048853 GTTGATGGATCTACCATTCTGGG - Intergenic
1195712393 X:107784125-107784147 GATGGTGGATGTATAACACTTGG + Intronic
1195805433 X:108760336-108760358 GGTGATGGTTGTACAGCTCTGGG - Intergenic
1196543331 X:116934726-116934748 GGAGATGGATCTACAATTCTAGG - Intergenic
1197660988 X:129171922-129171944 AATGATGGTTGTGCAACTCTGGG + Intergenic
1197799354 X:130333498-130333520 GGTGATGGTTGCACAACATTGGG + Intergenic
1199060523 X:143350708-143350730 GTTGGTGGATGTACAATTCTGGG + Intergenic
1199515223 X:148668327-148668349 GTTGATGGATCTACCATTCTGGG + Intronic
1200496148 Y:3886432-3886454 GTTGGTGGATGTACAATTCTGGG + Intergenic
1201731094 Y:17204053-17204075 GGTGATTGTTGCACAACACTGGG + Intergenic