ID: 1142470715

View in Genome Browser
Species Human (GRCh38)
Location 17:161848-161870
Sequence GGCCCCAGGAAGCACCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142470709_1142470715 -6 Left 1142470709 17:161831-161853 CCTCCAGCACCCTGAGAGGCCCC 0: 1
1: 1
2: 15
3: 192
4: 1421
Right 1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG 0: 1
1: 0
2: 4
3: 31
4: 361
1142470710_1142470715 -9 Left 1142470710 17:161834-161856 CCAGCACCCTGAGAGGCCCCAGG 0: 1
1: 1
2: 19
3: 164
4: 1511
Right 1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG 0: 1
1: 0
2: 4
3: 31
4: 361
1142470706_1142470715 15 Left 1142470706 17:161810-161832 CCGGTTCTCTGGAGGGAACCACC 0: 1
1: 0
2: 0
3: 14
4: 136
Right 1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG 0: 1
1: 0
2: 4
3: 31
4: 361
1142470708_1142470715 -3 Left 1142470708 17:161828-161850 CCACCTCCAGCACCCTGAGAGGC 0: 1
1: 3
2: 7
3: 74
4: 547
Right 1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG 0: 1
1: 0
2: 4
3: 31
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142470715 Original CRISPR GGCCCCAGGAAGCACCTTCA GGG Intronic
900959114 1:5908141-5908163 GGACCCTGGCAGCATCTTCAGGG + Intronic
902041897 1:13498742-13498764 CACCCCAGGAAACACCTGCAGGG - Intronic
902664996 1:17931238-17931260 TGCCCCAGGAAGGACTTGCAAGG - Intergenic
902746724 1:18479547-18479569 GGCCACAGGAAGCACACGCATGG - Intergenic
902959632 1:19953887-19953909 GGCAACAGGAAGGACCATCAGGG + Intergenic
904909578 1:33923911-33923933 GGCACCAGGAACCAATTTCATGG - Intronic
905417215 1:37812222-37812244 GGAGCCAGAAAGAACCTTCATGG - Exonic
906187930 1:43875685-43875707 GGCCTCAGGAAACACAATCATGG - Intronic
906616300 1:47235147-47235169 GTCCCCAGCCAGCACCTCCAAGG + Intergenic
906750189 1:48251844-48251866 GATCCCAGGAAACACCTCCAAGG - Intergenic
907240393 1:53077839-53077861 GGGCCCGGGAAGCTCCTTCAGGG + Intronic
907872415 1:58455133-58455155 GATCCCAGGAAACACCTGCAGGG + Intronic
909008182 1:70301941-70301963 ATCCCCAGGAAGCTCCTTTAAGG + Intronic
909131296 1:71740537-71740559 GGCCCCAGGAAACATCTTTGTGG - Intronic
909595832 1:77405476-77405498 GGCCCCAGCCAGCCTCTTCAAGG + Intronic
915031205 1:152881786-152881808 GGCCTCAGGAAACACAATCATGG + Intronic
915681869 1:157589282-157589304 GACCCCAGGAAACACCCTCGAGG - Exonic
915844412 1:159248727-159248749 GGCCTCAGGAAGCACAATTATGG - Intergenic
915886516 1:159728182-159728204 GGCCTCAGGAAACACAATCAAGG + Intergenic
916414331 1:164578581-164578603 GGCCCCTGGAAGCTCCTTGAGGG - Intronic
918232847 1:182551300-182551322 GGCTCCAGCAAACACCCTCAAGG - Intronic
918975328 1:191476643-191476665 ATCACCAGGAACCACCTTCATGG + Intergenic
919704058 1:200659523-200659545 GGCACCAGGAAGGACCTTGTAGG + Intronic
920721704 1:208393522-208393544 TGCCCCAGAAAGCTCCATCAAGG + Intergenic
921836671 1:219785445-219785467 CTCCCCAGGAAGGACCTTCCCGG + Intronic
922137047 1:222839381-222839403 GGCACCAGGAACCAATTTCATGG - Intergenic
923410002 1:233698712-233698734 GGCCTCAGGAAACACAATCATGG + Intergenic
924587439 1:245372302-245372324 GGCACCAGGGACCAGCTTCATGG - Intronic
1064627953 10:17280877-17280899 GGCCTCAGGAAACACAATCATGG + Intergenic
1069560138 10:69423399-69423421 GGCCCCAGAAAGGGCATTCAAGG - Intergenic
1069607304 10:69747770-69747792 TGCCCCAGGGAGCTCTTTCATGG - Intergenic
1069923339 10:71831079-71831101 GGGCCCCAGAAGCACCTTCAAGG + Intronic
1069929451 10:71872753-71872775 GGTCCCAGAAGGCACCTTCTGGG + Intergenic
1070225858 10:74504843-74504865 GGCCTCAGGAAACACAATCATGG - Intronic
1070546310 10:77455669-77455691 TTCCCCATGAATCACCTTCAAGG + Intronic
1071197490 10:83178022-83178044 GGCCTCAGGAAACACAATCATGG + Intergenic
1072201717 10:93166069-93166091 GATCCCAGGAAACACCTGCAAGG + Intergenic
1072537464 10:96374477-96374499 TGCTCCAGGCAGCACCCTCATGG + Intronic
1072625747 10:97110354-97110376 TGCACCAGGAAGCACCTGCCAGG + Intronic
1073232363 10:101982980-101983002 GGCACCAGGAACCAGTTTCATGG - Intronic
1073591481 10:104761821-104761843 ATCCCTAGGAAGCACTTTCAGGG + Intronic
1075048103 10:119162032-119162054 GGCTCCAGGAATCAGCTGCAGGG + Intronic
1075553551 10:123412204-123412226 GGCCTCAGGAAACACAATCATGG - Intergenic
1075729719 10:124628935-124628957 GCTCCCAGCAAGAACCTTCAGGG - Intronic
1076025386 10:127107738-127107760 GAGCCCTGGAAGCACCTGCACGG - Intronic
1076649802 10:131980041-131980063 GGCCCAAGGAATCGCCTACATGG + Intronic
1076885243 10:133259134-133259156 GGTCTCAGGAAGGAACTTCAGGG - Intergenic
1078087286 11:8241847-8241869 GGCCCCAAGAACAGCCTTCATGG - Intronic
1079080144 11:17408280-17408302 TGCCCCAGGAAGCCCCCTAAAGG - Intronic
1080869102 11:36221468-36221490 AACCCCAAGAAGCACCTACAGGG + Intronic
1080933389 11:36837231-36837253 TCCCCCAGGAAGCACCTGAATGG - Intergenic
1081629908 11:44681939-44681961 TCCCCCAAGAAGCAACTTCATGG + Intergenic
1083694947 11:64436549-64436571 GGCCCCAGGAACCCCCTCCAGGG - Intergenic
1084117909 11:67052632-67052654 GGCCCAAGGACACACCTCCAGGG + Intergenic
1084984856 11:72859934-72859956 GGCACCAGGAACCAGTTTCATGG + Intronic
1086181179 11:83953535-83953557 GGCACCAGGGACCACTTTCATGG - Intronic
1087576244 11:99993439-99993461 GGCACCAGGGATCAACTTCATGG + Intronic
1087729253 11:101759943-101759965 TGCCCCAGGAAGCACCAGTAGGG + Intronic
1090206788 11:124888961-124888983 GGGACCAGGCAGGACCTTCAGGG + Intronic
1091302073 11:134514314-134514336 GGTCCCTGGAAGCAGCCTCAGGG + Intergenic
1091329979 11:134724777-134724799 GATCACAGGAAGCACCTGCAGGG - Intergenic
1091522320 12:1258439-1258461 GCCACCAGGAAGCACTTTCCAGG + Intronic
1091942276 12:4498685-4498707 GGCACCAGGAACCAGTTTCACGG + Intronic
1093224545 12:16465807-16465829 GGCACCAGGGACCACTTTCATGG - Intronic
1093714146 12:22362315-22362337 GGCACCAGGGACCAGCTTCATGG - Intronic
1095952491 12:47789457-47789479 GCCCCCAGGAACTTCCTTCAGGG - Intronic
1097172998 12:57128016-57128038 GGGCAGAGGAGGCACCTTCAGGG + Intronic
1097973881 12:65664323-65664345 GGCACCAGGAACCAGTTTCATGG + Intergenic
1099254027 12:80293483-80293505 GGCCCCAGGCAGCAGAGTCATGG + Intronic
1099558832 12:84147706-84147728 GGCCTCAGGAAACACAATCATGG - Intergenic
1100810141 12:98329764-98329786 GGCCTCAGGAAACACAATCACGG + Intergenic
1101408673 12:104451973-104451995 GGCCACACGAATCACCTCCAAGG + Intergenic
1101522723 12:105499638-105499660 AGCCCCAGGCAGGTCCTTCAGGG + Intergenic
1103015574 12:117492140-117492162 GGCCTCAGGCAGTACCCTCAAGG + Intronic
1103269137 12:119657634-119657656 AGCCCCAGGAAACACAATCATGG + Intergenic
1103443418 12:120979505-120979527 GGGCCCAGGAAGCACTGCCAGGG + Intronic
1103870197 12:124085756-124085778 GACCCCAGGAAGCACCAGCCAGG - Intronic
1103958494 12:124593055-124593077 GGCCCCAGGAAGCCCCTCAGAGG + Intergenic
1104361437 12:128136873-128136895 GGCACCAGGGACCACTTTCATGG + Intergenic
1104985365 12:132593609-132593631 GGCCTCAAGATGCCCCTTCAGGG + Intergenic
1105828405 13:24143053-24143075 GATCCCAGGAAGCACCTGCCGGG + Intronic
1107812084 13:44210236-44210258 GGCCTCAGGTAACACCTTCTTGG - Intergenic
1107815783 13:44243276-44243298 TGCCGCAGGAAGCACCTGCACGG - Intergenic
1108521100 13:51247546-51247568 GCCACCAGGAAGTCCCTTCAAGG - Intronic
1109804837 13:67425641-67425663 GGCCTCAGGAAACACAATCATGG + Intergenic
1109934602 13:69264878-69264900 TGCCTCAGGAAGCACCAGCAAGG - Intergenic
1110412819 13:75222322-75222344 AGCCCCATGAGGCACTTTCATGG + Intergenic
1113013100 13:105793416-105793438 GGCCTCAGGAAACATATTCATGG + Intergenic
1113158238 13:107349886-107349908 GGCACCAGGAACCGACTTCATGG + Intronic
1113466803 13:110518767-110518789 TGACCCAGGAGGCACCTTCTCGG + Intergenic
1113625919 13:111846289-111846311 GGCCCCAGGAAGGACAGTGAGGG + Intergenic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1114591223 14:23866496-23866518 GACCCCAGGAAGCTCCAGCAAGG - Intergenic
1114780574 14:25534005-25534027 GGCCTCAGGAAACACAATCATGG + Intergenic
1115457280 14:33618162-33618184 GGCACCAGGAACCAGTTTCATGG + Intronic
1115505138 14:34086613-34086635 GGCCTCAGGAAACACAATCATGG + Intronic
1115957574 14:38798321-38798343 GGCCTCAGGAAACACAGTCATGG - Intergenic
1116503035 14:45644249-45644271 GCCTCCAGGAAGCCCCCTCATGG + Intergenic
1116966118 14:51016743-51016765 GGCACCAGGGAGCAGTTTCATGG - Intronic
1118005595 14:61562131-61562153 GGCTCCAGGAAGCACATGAAGGG + Intronic
1118019528 14:61696052-61696074 GGCCCCTGAAAGCACTTTCGAGG - Intronic
1118056434 14:62084026-62084048 GGGCCCAGGGAGCACAGTCACGG - Intronic
1118815701 14:69312402-69312424 GGCCCCAAGAAACACCCTCTGGG - Intronic
1119184075 14:72625383-72625405 GGACACAGGAAGCAACTTGAAGG - Intronic
1119261329 14:73239852-73239874 GGCCCCCGGAGGAACCTGCAGGG + Intronic
1119765907 14:77187512-77187534 GGCCCCAAGAAGCCCCTCCATGG - Intronic
1120152280 14:81049893-81049915 GGCCTCAGGAAACACAATCATGG - Intronic
1120267619 14:82271575-82271597 AGCCTCAGGCAGGACCTTCAAGG + Intergenic
1120771262 14:88382970-88382992 GGCCTCAGGAAACACTATCATGG - Intergenic
1121096251 14:91219953-91219975 GGCCTCGGGAAGCCCCCTCATGG + Intronic
1121102586 14:91260236-91260258 GGCTCCAGGGTGCACCTTCCTGG - Intergenic
1121149218 14:91615394-91615416 GGCACCAGGAACCAGTTTCATGG - Intronic
1121181202 14:91930384-91930406 GGCCCCAGCAAGCTTGTTCATGG - Intronic
1122346558 14:101064614-101064636 CGCTCCAGGAGGCACCTTCTGGG + Intergenic
1122986112 14:105212450-105212472 GGCACCAGGCAGCTCCTTGAGGG - Intronic
1202918382 14_KI270723v1_random:6056-6078 GGCCCCACGCAGCCCCTCCAAGG + Intergenic
1202926244 14_KI270724v1_random:28515-28537 GGCCCCACGCAGCCCCTCCAAGG - Intergenic
1123451050 15:20358796-20358818 GACCCCAGGAAGCCCCTCCAGGG - Intergenic
1124006994 15:25802440-25802462 AGCCCCAGGAAGCGAGTTCATGG - Intronic
1124616423 15:31245550-31245572 GGCTCCAGGATGCTCCTGCATGG - Intergenic
1124640281 15:31392514-31392536 GGACCCAGGATGCGCCGTCAGGG - Intronic
1126778762 15:52120538-52120560 GGCCCAGGGAAGCACATTCCAGG - Exonic
1126821699 15:52510769-52510791 GGCCCCAGGGACCAGTTTCATGG - Intronic
1127144511 15:56010734-56010756 GGCCTCAGGAAACACAATCATGG - Intergenic
1128682131 15:69659926-69659948 GGCCCCAGGCATCACATTCCTGG - Intergenic
1128718849 15:69930791-69930813 TGCTGCAGGAAGCACCTTCTTGG - Intergenic
1128983149 15:72200698-72200720 GGCCCCAGGAAGTACCCTCAGGG + Intronic
1130650343 15:85758935-85758957 GGCTCCAGGAGGCAGCTTCACGG - Intergenic
1131105251 15:89729478-89729500 GGCCCCAGGAACAGCCCTCATGG + Intronic
1132014541 15:98303986-98304008 GTCACCAGGAAGCATCTTCCTGG - Intergenic
1132033303 15:98457084-98457106 GGCACCAGGAACCAGTTTCATGG + Intronic
1132350084 15:101133979-101134001 GGCCCCAGGAAGTTCCTGCCAGG + Intergenic
1132544199 16:525837-525859 GGCCTCAGGAGGCGTCTTCAAGG - Intergenic
1132648045 16:1008041-1008063 GGACCCAGGAAGCCCCTTCAAGG + Intergenic
1132734187 16:1377512-1377534 GGCCCCAGAAAACAGCTGCAGGG - Intronic
1133239077 16:4403982-4404004 GCCCCCAGGGAGCCCCTTCTGGG - Intronic
1135042217 16:19126401-19126423 GGCACCAGGAACCAGTTTCATGG - Intronic
1135503831 16:23019520-23019542 GGCCACAGGAAACACCTTTCAGG - Intergenic
1135983468 16:27166790-27166812 GCCCCTATGAAGCCCCTTCAAGG + Intergenic
1136010838 16:27362707-27362729 GGCCCAAGGAGGCACCTCCCTGG + Exonic
1138216607 16:55210356-55210378 GGTCCCAGGAAGTACCAGCAGGG + Intergenic
1138456935 16:57126470-57126492 GTCCCCAGGAAGCAAGGTCATGG - Intronic
1139303194 16:65962432-65962454 GCCCACAGGAAGCACGTGCACGG - Intergenic
1140409717 16:74734436-74734458 GGGCCCAGGAAGCAGATGCAAGG + Intronic
1141202044 16:81905548-81905570 GGCTCCAAGAAGCAGCTGCAAGG - Intronic
1142469997 17:157966-157988 GGCTCCAGGTAGCACCTTCAGGG - Intronic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143179187 17:4973655-4973677 GGCCCATGGAAGCCCCTTCCGGG - Exonic
1143581987 17:7833097-7833119 GGTCCCAGCCAGCACCTTCCAGG - Exonic
1144523922 17:15973705-15973727 GGCACCAGGGACCAGCTTCATGG - Intronic
1146669725 17:34728666-34728688 CGCCCCAGGAAGGCCCGTCATGG + Intergenic
1147120053 17:38330527-38330549 TGCCCCAGGAAGGCCCCTCAGGG - Exonic
1147456627 17:40542103-40542125 GGCCCCAGCCAACACCTTGATGG - Intergenic
1147862995 17:43534533-43534555 GGCCCCAGAAAACACTTTCAAGG + Intronic
1148027999 17:44601558-44601580 GGGCAGAGGAAGCACCTGCAGGG + Intergenic
1149507936 17:57211397-57211419 GGTCCCAGGAGGCACCCTCAAGG + Intergenic
1151360290 17:73584567-73584589 GTACCCAGGGAGCACCTTCTGGG + Intronic
1152337396 17:79706550-79706572 GGCCCCAGGCAGCCCCTCCAGGG + Intergenic
1155263441 18:24067703-24067725 GGCACCAGGGACCAGCTTCACGG - Intronic
1156536495 18:37869614-37869636 GGCACCAGAGAGCAGCTTCATGG + Intergenic
1156957631 18:42987787-42987809 GGCCTCAGGAAACACACTCATGG + Intronic
1157003869 18:43559254-43559276 TGTCCCAGGAAGCACCTGGATGG - Intergenic
1158498196 18:57975534-57975556 GACCCTAGGAAGGATCTTCATGG + Intergenic
1159212818 18:65349048-65349070 GGCCTCAGGAAACACAATCACGG - Intergenic
1160333504 18:78016723-78016745 GGCCCCGCGAAGCACCTTTCAGG + Intergenic
1160526782 18:79543154-79543176 GGTCCCAGGAGGCACCCGCAGGG + Intergenic
1160963700 19:1736349-1736371 GCCCCCAGGAAGCCCCCCCAGGG + Intergenic
1161236006 19:3198629-3198651 AGCCCCAGGGAGCTCCTCCAGGG - Intronic
1161729818 19:5952411-5952433 AGTCCCAGGAACCACCTTAAAGG - Intronic
1161873244 19:6886807-6886829 GGCCCCAGAAAGCACCAGCTGGG - Intergenic
1162034543 19:7932001-7932023 GGCCTCTGGAAGGCCCTTCATGG - Intronic
1162561572 19:11420749-11420771 GGCCCCACGGGGCCCCTTCAGGG - Exonic
1162842254 19:13365066-13365088 GATCCCAGGAAGCACCATCGGGG - Intronic
1163752065 19:19083957-19083979 TGCCCCTGCAGGCACCTTCAGGG + Intronic
1164792128 19:30996346-30996368 GACCCCAGGAAGCACCAGTAGGG + Intergenic
1165138761 19:33686959-33686981 GGGACCAGGAAGAACCTGCAAGG - Intronic
1166532865 19:43552981-43553003 GGCCATAGGCAGCACCTCCAAGG - Exonic
1167159053 19:47755815-47755837 GGACACAGTGAGCACCTTCAGGG - Exonic
925323489 2:2996636-2996658 AGCCCCAGGAAACAGATTCAAGG + Intergenic
925926545 2:8675224-8675246 GGCACCAGGAACCGGCTTCATGG - Intergenic
925976191 2:9143644-9143666 GGCCCCCGGAAGAAGCTTCGTGG - Intergenic
927098775 2:19770635-19770657 GGCCTCAGGAAACACAATCATGG + Intergenic
927210333 2:20635134-20635156 AGCCCCCAGAAGCAGCTTCAGGG + Intronic
927462055 2:23307729-23307751 GGCCTCAGGAAACACAATCATGG + Intergenic
927878618 2:26675099-26675121 GCCCCCAGGGCGCATCTTCATGG - Intergenic
928899388 2:36301177-36301199 GGCCTCAGGAAACACAATCATGG + Intergenic
929085616 2:38164702-38164724 GGCCTGAGGGAGCACCATCATGG - Intergenic
930033858 2:47073739-47073761 GGCATCACGAAGCACCTTCTGGG - Exonic
930105670 2:47637412-47637434 AGCCACAGGAAGCAAGTTCAAGG - Intergenic
931489039 2:62724943-62724965 GGCACCAGGAACCAATTTCATGG - Intronic
931633626 2:64322809-64322831 GTTCCCAGGAAGCTCCCTCAGGG - Intergenic
934574038 2:95389390-95389412 GGCCCGAGGAAGCTCCTTGGAGG + Intergenic
934653322 2:96104438-96104460 GGCCCCAGGCTGCCCCCTCAGGG - Intergenic
935018973 2:99212242-99212264 GGCACCAGGAACCAGTTTCATGG + Intronic
935276112 2:101476545-101476567 GGCCCCAGCAACTACCTTCCAGG - Intergenic
937441797 2:121921690-121921712 TGCACCAGGAAGCTCCTTCAGGG - Intergenic
940152275 2:150615676-150615698 GGCTCCAGGAAGAACCCTGAGGG + Intergenic
941230344 2:162904117-162904139 GGCACCAGGGAGCAGTTTCATGG - Intergenic
942553476 2:177146165-177146187 AGTCCCAGGAAGCACCCACAAGG + Intergenic
943452946 2:188068321-188068343 GACCTCAGGAAACACATTCATGG + Intergenic
945119615 2:206443917-206443939 GGCCGCAGGAAGCGCCGGCAAGG - Exonic
945411553 2:209515432-209515454 GGCCCCAGGAAACACAATCATGG + Intronic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
947321338 2:228922529-228922551 GGCACCAGGAAGCAGTTTCATGG + Intronic
948209702 2:236183709-236183731 GGCCTCAGGAAGCTCAATCATGG - Intergenic
948941884 2:241200906-241200928 GGCCCCATGACGGAGCTTCAGGG + Intronic
949007722 2:241659300-241659322 GGCCCCACGGAGCACCTGCACGG - Intronic
1171253006 20:23663629-23663651 GGACACAGGAAGCAGCTTAAAGG + Intergenic
1171253089 20:23664926-23664948 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1171259493 20:23718947-23718969 GGACACAGGAAGCAGCTTAAAGG + Intergenic
1171259576 20:23720240-23720262 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1171268642 20:23795700-23795722 GGACACAGGAAGCAGCTTAAAGG - Intergenic
1172806462 20:37615423-37615445 AGCCCCAGGGAGCACATTCAGGG - Intergenic
1173177838 20:40777860-40777882 GGTCCCAGGAAGCACCAGTAGGG + Intergenic
1174149790 20:48478002-48478024 GGTGCCAGGAAGGACCTTCTTGG - Intergenic
1174390047 20:50213515-50213537 GGCCCCAAGCCCCACCTTCATGG + Intergenic
1174541459 20:51292984-51293006 GGCCTCAGGAAACACAATCATGG + Intergenic
1174747709 20:53080480-53080502 GGCACCAGGGATCAGCTTCATGG + Intronic
1175130971 20:56789171-56789193 GGGGCCAGGCAGCACTTTCATGG - Intergenic
1176020191 20:62958769-62958791 AGTCCCAGGCAGCACCTTCCAGG - Intronic
1176308081 21:5134804-5134826 GCCCCCAGGCAGCACGTCCAGGG + Intronic
1179793976 21:43771704-43771726 GGCCTCAGGAAACACAATCATGG + Intergenic
1179848979 21:44127228-44127250 GCCCCCAGGCAGCACGTCCAGGG - Intronic
1179921875 21:44511979-44512001 GGCCCCGGGCAGCCCCTCCATGG - Intronic
1180185527 21:46137342-46137364 GACCCCAGGGAGCCCCTACATGG + Intronic
1180743750 22:18072603-18072625 GGCTCCTGGAGTCACCTTCAAGG + Intergenic
1181395522 22:22618538-22618560 GGCCACAGGAAGCAGCATCAGGG + Intergenic
1181423663 22:22819091-22819113 GGCCTCAGGAAGCAGCATCGGGG + Intronic
1181568622 22:23754240-23754262 GGCCCCAGAAGGCCCCTGCAAGG - Intronic
1181660768 22:24346661-24346683 GGCCCCAGGAAGGATCCTTATGG + Intronic
1181881230 22:25981984-25982006 GGCCTCAGGAAGCACAATCATGG + Intronic
1183745492 22:39689281-39689303 GGCACCAGGCAGCCCCTTAAAGG + Exonic
1183773754 22:39948919-39948941 AGCCAAAGGCAGCACCTTCAGGG - Intronic
1184820154 22:46903926-46903948 TGCCCGTGGACGCACCTTCAAGG + Intronic
1184890639 22:47376901-47376923 TGCCCCCGGGAGCCCCTTCAGGG + Intergenic
1185246276 22:49774968-49774990 GGAACCAGGAAGCACCTGCCCGG + Intronic
949477488 3:4462418-4462440 GGCCTCAGGCAGCATCTCCAAGG - Intronic
950504810 3:13388078-13388100 GGCCCCAGAAAGCATCTCTAGGG - Intronic
951034851 3:17921635-17921657 GGCCTCAGGAAACACAATCATGG - Intronic
952120139 3:30232459-30232481 GGCCTCAGGAAACACAATCAAGG + Intergenic
952845286 3:37683036-37683058 GACCCTCGGAAGCCCCTTCAGGG - Intronic
952969563 3:38642121-38642143 TGGCCCAGGAAACACCGTCATGG + Intronic
953489626 3:43337686-43337708 GGCCTCAGGAAACACAGTCATGG + Intronic
953940126 3:47087294-47087316 GGCACCAGGAACCAGTTTCAGGG + Intronic
954472034 3:50706123-50706145 GGCCTCAGGAAACACAATCATGG - Intronic
955489206 3:59465462-59465484 GGCCCCAGCAAGCGGCTTAAGGG - Intergenic
955541771 3:59984277-59984299 GGGCCCAGGAAGCACCATTAGGG + Intronic
957784638 3:84866338-84866360 GGCCTCAGGAAACACAATCATGG - Intergenic
958610348 3:96416693-96416715 TGTCCCAGGAAGCACCTAGATGG - Intergenic
958804106 3:98788682-98788704 GACCCCAGGAAGGCCCTACAAGG - Intronic
958836909 3:99156915-99156937 AGCCCAAGAAAGCAGCTTCAGGG + Intergenic
960268001 3:115643326-115643348 GGACCCAGGAAACACAGTCAAGG - Intronic
961031756 3:123611546-123611568 GGCACCAGGGACCACTTTCATGG + Intronic
961047789 3:123721386-123721408 GGACCCAAGAAGCACTTCCACGG + Intronic
962385833 3:134931536-134931558 GTCCTCTGGAACCACCTTCAGGG + Intronic
964816163 3:160719834-160719856 TCCCCCAGGAAGCACCCTGACGG + Intergenic
968735124 4:2291343-2291365 GGCTCCAGGAAGCATTCTCAAGG - Intronic
968925247 4:3543555-3543577 GGATCCAGGAAGCACCTACCTGG + Intergenic
968972533 4:3803476-3803498 GGCCACAGGAAGCCCCAACATGG - Intergenic
969103498 4:4787694-4787716 GGCCTCAGGAAACACAATCATGG - Intergenic
969248551 4:5952502-5952524 GGCCCCAGGCGGCACAGTCAAGG + Intronic
969880184 4:10166980-10167002 GGCACAACGTAGCACCTTCAAGG + Intergenic
972675080 4:41252287-41252309 GGCCCCAGGGACCAGTTTCATGG + Intergenic
972716152 4:41648399-41648421 GGCCTCAGGAAGCACTTCCATGG + Intronic
973040667 4:45466256-45466278 GGCCTCAGGAAACACAATCATGG + Intergenic
975169929 4:71221990-71222012 GGTTTCAGGAAGCACCTTAATGG + Intronic
975470013 4:74755246-74755268 GGTCCCAGGAAGCACATTAGTGG + Intronic
976317952 4:83679608-83679630 CTCCCCAGGAAGCTTCTTCAAGG - Intergenic
977138724 4:93339786-93339808 GGCCTCAGGAAACACAATCATGG + Intronic
977908111 4:102501008-102501030 GCCCCCAGGAAGCGCCTGCCGGG - Intergenic
979357825 4:119726237-119726259 GGAACCAGGAAGCACGTTGAAGG - Intergenic
980576405 4:134688097-134688119 GGCCCCAGGAAGACCCTACTTGG + Intergenic
982154811 4:152508136-152508158 GGCCCCATGAAGCCTCTTCAAGG - Intronic
982351249 4:154417457-154417479 GGCCCCAATAAGCTGCTTCAAGG + Intronic
983631808 4:169857032-169857054 GGCACCAGGAACCAGTTTCATGG + Intergenic
985160982 4:187044307-187044329 GGCACCAGGAATCAGTTTCATGG - Intergenic
985527191 5:412015-412037 GGCCCCGGGAAGCTGCTGCAGGG + Intronic
986601523 5:9477960-9477982 GGGCCCAGGAAGGTCCCTCATGG - Intronic
987633438 5:20506867-20506889 ACACCCAGGAAGCACATTCAAGG - Intronic
987836409 5:23168695-23168717 GGCACCAGGAACCAGTTTCATGG - Intergenic
988119453 5:26942111-26942133 GGCCTCAGGAAACACAATCATGG + Intronic
988452468 5:31357092-31357114 GGCACCAGGAACCAGTTTCATGG + Intergenic
988879392 5:35484637-35484659 AGCCCCAGCCAGCATCTTCATGG - Intergenic
989149590 5:38285708-38285730 GGCCTCAGGAAACACAATCATGG + Intronic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
989716405 5:44468347-44468369 GGCCCCAAGAGGCACCTTGTTGG + Intergenic
991663134 5:68970296-68970318 GGCCTGAGGATGCACCATCAGGG - Intergenic
992705921 5:79392233-79392255 AGCCCCAGGCAGGTCCTTCAGGG + Intronic
993502665 5:88680398-88680420 GGCCTAAGGAAGTACCTTCGGGG - Intergenic
994545054 5:101155724-101155746 GGCCCCAGGAAACACAATCATGG + Intergenic
996026863 5:118656628-118656650 GGCCTCAGGAAACACAATCATGG + Intergenic
997732649 5:136192443-136192465 GGCCCCAGGAGCCACGGTCAAGG - Intergenic
999194245 5:149771306-149771328 GGCCCCTGGAAGCAGGCTCAGGG + Intronic
999504363 5:152179824-152179846 GGCCTTAGGCAGCTCCTTCATGG + Intergenic
999504528 5:152181126-152181148 GGCCTCAGGAAACACATTCATGG + Intergenic
1000287981 5:159844390-159844412 TGCTCCAGGAAGCTCCTTCCTGG - Intergenic
1000561225 5:162791919-162791941 GGCCTCAGGAAACACAGTCATGG + Intergenic
1000913454 5:167050430-167050452 GGCACCAGGGATCAGCTTCATGG - Intergenic
1003344897 6:5257802-5257824 GGCACCAGGAACCAATTTCATGG - Intronic
1003505778 6:6739204-6739226 GACCCCAGCCTGCACCTTCATGG + Intergenic
1006822347 6:36907426-36907448 GGCACCAGGAAGCTCCCTGATGG + Intronic
1007095149 6:39208359-39208381 GCCCCCAGGGAGCTCATTCAAGG + Intronic
1008483795 6:52013882-52013904 AGCCACAGGAAGCAACTTCAGGG - Intronic
1008547756 6:52598407-52598429 GGCCCCAGGAAGTACAGGCAGGG - Intergenic
1012064746 6:94536581-94536603 GGCCTCAGGAAACAAATTCATGG + Intergenic
1012578417 6:100831608-100831630 GGCCCCAGGAATCATTTTGATGG - Intronic
1012996101 6:105976465-105976487 GGACACAGGAGGCAACTTCAAGG + Intergenic
1014282613 6:119458436-119458458 GGCCTCAGGAAACACAATCATGG - Intergenic
1014403035 6:121014825-121014847 GGCCTCAGGAAACACAATCATGG + Intergenic
1014951359 6:127559234-127559256 GGCCTCAGGAAACACAATCATGG - Intronic
1015985614 6:138881440-138881462 GGCACCAGGAACCAGTTTCATGG + Intronic
1016326865 6:142912809-142912831 GGCACCAGGAACCAGTTTCATGG - Intronic
1016441156 6:144084796-144084818 GGCCCCAGGGACCAGTTTCATGG - Intergenic
1017615771 6:156244931-156244953 GGAGCCAGAAGGCACCTTCAAGG + Intergenic
1017823428 6:158064780-158064802 GGCCCCAGGGACCCCCCTCACGG + Intronic
1018319612 6:162593597-162593619 GCCCCCAGCAAGCAACTTGAAGG - Intronic
1018555292 6:165043112-165043134 TGCCTCAGGCAGCACCTACAGGG + Intergenic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1019560439 7:1653444-1653466 GGCCCCAGGACGCAGATACAGGG + Intergenic
1019561629 7:1662188-1662210 GGGCGCAGGAACCACCTGCAGGG + Intergenic
1022459218 7:30588077-30588099 AGCCCCAAGAGGCACCTTGAAGG + Intergenic
1023395245 7:39745771-39745793 AGCCCCAGGCAGCATCTCCAGGG - Intergenic
1023545708 7:41315991-41316013 TGCCCCATGCAGCACCTTCCAGG - Intergenic
1024895872 7:54261341-54261363 GGCCTCAGGAAACACAGTCATGG + Intergenic
1025267392 7:57474928-57474950 GGCCTTTGGAAGCTCCTTCATGG - Intergenic
1025842626 7:65164983-65165005 GGTCCCAGTAAGCAGATTCATGG + Intergenic
1025880419 7:65530985-65531007 GGTCCCAGTAAGCAGATTCATGG - Intergenic
1025893018 7:65671619-65671641 GGTCCCAGTAAGCAGATTCATGG + Intergenic
1026152275 7:67798271-67798293 GGCACCAGGAACCAGTTTCATGG + Intergenic
1026341554 7:69438620-69438642 GATCCCAGGAACCAACTTCAGGG + Intergenic
1026575514 7:71568101-71568123 TGCCCAGGGAAGCACCTTAACGG + Intronic
1028142985 7:87291930-87291952 TGTCCCAGGAAGCACCTAGATGG + Intergenic
1028517822 7:91697823-91697845 GGTCCCTGGAAGCACCATGAAGG - Intronic
1029151479 7:98483680-98483702 GATCCCAGGAAGCATTTTCAGGG - Intergenic
1030263303 7:107589178-107589200 GGCACCAGGGACCAGCTTCATGG + Intronic
1030382185 7:108824933-108824955 TGCCACAGGAAGCCCCGTCATGG - Intergenic
1032413998 7:131722296-131722318 GCCCCCAAGAAGCAGCTTCAAGG - Intergenic
1033730668 7:144175815-144175837 GGCCTCAGGAAACACAATCATGG - Intergenic
1033843324 7:145401999-145402021 GGCCACAGGAAACACAATCATGG - Intergenic
1034201102 7:149283497-149283519 GACCCCAGAAAGCACCCTGAGGG + Exonic
1034229599 7:149511387-149511409 GGCCTCAGGAAACACAATCATGG - Intergenic
1034477638 7:151296018-151296040 GGCCTCAGGAAACACAATCATGG + Intergenic
1034926703 7:155128509-155128531 GGCCTCAGGAAACACAATCATGG - Intergenic
1035109720 7:156470985-156471007 GGCCTCAGGAAACATCATCATGG - Intergenic
1035610752 8:962507-962529 AGCCCCAGGAGGCTCCCTCAAGG - Intergenic
1036057277 8:5270234-5270256 GGCCTCAGGAAACACATTCATGG - Intergenic
1036382669 8:8247715-8247737 GGCACCAGGAACCAGTTTCATGG - Intergenic
1036966315 8:13301939-13301961 GGCACCAGGAACCAGTTTCATGG - Intronic
1037294450 8:17385785-17385807 GGCCACAGGAAACACAATCATGG - Intronic
1037566861 8:20125434-20125456 GGCCTCAGGAAACACAGTCATGG + Intergenic
1038188211 8:25294791-25294813 GGCCTCAGGAAACACAATCATGG + Intronic
1039332792 8:36557670-36557692 GCACCCTGGAAGCACTTTCATGG - Intergenic
1042290320 8:67164116-67164138 GGCCCAAGGAAGTTCCTTTACGG - Intronic
1042792426 8:72623393-72623415 AGCCCAAGGAAGCAGCATCAAGG + Intronic
1046611376 8:116429414-116429436 GGCCTCAGGAAACACAGTCATGG + Intergenic
1046663118 8:116970334-116970356 AGCCCCAGGCAGGTCCTTCAGGG - Intronic
1049323946 8:142012118-142012140 GGCCCCAGGAGGGACCTCCACGG + Intergenic
1049714509 8:144083525-144083547 GGGCCCAGAAAGCACCTTGGAGG + Intronic
1049718931 8:144106760-144106782 GGCCCCAGGGAGGATGTTCAGGG - Intronic
1051378605 9:16431698-16431720 GGCACCAGGGACCACTTTCATGG + Intronic
1051513746 9:17907019-17907041 AGCCCCAGGATGGACCTTCGCGG - Intergenic
1053557693 9:39154829-39154851 GGCCTCGGGGAGCACCTGCAGGG + Intronic
1053800137 9:41758737-41758759 GGATCCAGGAAGCACCTACCTGG + Intergenic
1053821807 9:41975117-41975139 GGCCTCGGGGAGCACCTGCAGGG + Intronic
1054139421 9:61464122-61464144 GGCCTCGGGGAGCACCTGCAGGG - Intergenic
1054188565 9:61970889-61970911 GGATCCAGGAAGCACCTACCTGG + Intergenic
1054608764 9:67212291-67212313 GGCCTCGGGGAGCACCTGCAGGG - Intergenic
1054649956 9:67617728-67617750 GGATCCAGGAAGCACCTACCTGG - Intergenic
1056570791 9:87813079-87813101 AGCCCCTGGACGCACCTTCCTGG + Intergenic
1056877614 9:90349681-90349703 TGTCCCAGGAAGCACCTGGATGG + Intergenic
1057205756 9:93171363-93171385 GGCCTCAGGCAGCCCCTACAGGG - Intergenic
1058066044 9:100549184-100549206 GGCCTCAGGAAACACAATCATGG + Intronic
1058460037 9:105174221-105174243 GGCCCCAGTAAGCAGACTCAGGG + Intergenic
1059051626 9:110932855-110932877 GGCCCCAGGAATCACTTTCATGG - Intronic
1059910860 9:119042602-119042624 CGCCCCAGGAATCCCCTTCCTGG - Intergenic
1060734832 9:126060184-126060206 GGCCCCAGGGAGAAGCTGCAGGG + Intergenic
1060933882 9:127505032-127505054 GGCAGCAGGCAGCAGCTTCAAGG - Intergenic
1061328957 9:129880383-129880405 GGTCCCTGAAAGCACCTTCCTGG + Exonic
1062009527 9:134259483-134259505 GGCCCTTGGAAACACCCTCATGG - Intergenic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1062086003 9:134648854-134648876 TGCCCAAGGATGCACCTTCCTGG - Intronic
1062500633 9:136850539-136850561 GGCCCCAGGATCCACCATCAAGG + Intronic
1185590683 X:1274815-1274837 GGCCGAAGGAAGCACGTACAGGG - Exonic
1185728132 X:2439451-2439473 GGCACCAGGAACCAGTTTCATGG + Intronic
1185779986 X:2835801-2835823 AGCCCCAGGAAGCTCATTCATGG + Intronic
1186042148 X:5492401-5492423 GGCCTCAGGAAACACAATCATGG - Intergenic
1188283928 X:28305083-28305105 GTCACCAGGAAGCAGTTTCATGG + Intergenic
1190357387 X:49618405-49618427 GCCCCCAGGAAGGTCCTTCTGGG - Intergenic
1193850628 X:86532560-86532582 GGCCTCAGGAAACACAATCATGG - Intronic
1194342509 X:92722083-92722105 GGACCCAGGCAGCCACTTCAAGG - Intergenic
1196068468 X:111492140-111492162 GGCCTCAGGAAGCACACTCTAGG - Intergenic
1196246344 X:113404297-113404319 GGCCTTAAGAAGCTCCTTCATGG - Intergenic
1199457792 X:148048617-148048639 GGACACAGGAAGCAACTTGAAGG + Intergenic
1200650870 Y:5838772-5838794 GGACCCAGGCAGCCACTTCAAGG - Intergenic
1201290063 Y:12414188-12414210 AGCCCCAGGAAGCTCATTCATGG - Intergenic
1202386549 Y:24332090-24332112 GGCCTCAGGAAACACAATCATGG + Intergenic
1202484236 Y:25338038-25338060 GGCCTCAGGAAACACAATCATGG - Intergenic