ID: 1142471026

View in Genome Browser
Species Human (GRCh38)
Location 17:163350-163372
Sequence CCTTCCCTAGAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 310}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142471018_1142471026 -3 Left 1142471018 17:163330-163352 CCATTTCTCCTACAGTCCTGCCT 0: 1
1: 0
2: 3
3: 44
4: 496
Right 1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 310
1142471017_1142471026 21 Left 1142471017 17:163306-163328 CCAGGAGTAGGTGGTGGGGCACT 0: 3
1: 0
2: 0
3: 11
4: 162
Right 1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 310
1142471015_1142471026 23 Left 1142471015 17:163304-163326 CCCCAGGAGTAGGTGGTGGGGCA 0: 3
1: 0
2: 2
3: 34
4: 271
Right 1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 310
1142471016_1142471026 22 Left 1142471016 17:163305-163327 CCCAGGAGTAGGTGGTGGGGCAC 0: 3
1: 0
2: 0
3: 16
4: 209
Right 1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG 0: 1
1: 0
2: 2
3: 65
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142471026 Original CRISPR CCTTCCCTAGAGAAGGGGGA AGG Intronic
900489405 1:2939415-2939437 CCATCCCCACAGATGGGGGAAGG + Intergenic
900946157 1:5832425-5832447 CCTTCCCTGGAGAAGGGGGTTGG - Intergenic
900946164 1:5832432-5832454 CCTTCTCCAGGGAAGGGAGAAGG + Intergenic
901198810 1:7455191-7455213 CCTGCACTAGAGAAGCAGGAGGG - Intronic
901251913 1:7785049-7785071 CCTTCCCTGGAGCAGGGAAAGGG + Intronic
901285697 1:8076924-8076946 CCTTCCCTCGTGCAGAGGGAAGG - Intergenic
902513713 1:16979277-16979299 CCCTCCCTACAGAAGGCTGACGG - Intronic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
904713268 1:32447772-32447794 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
905371836 1:37486590-37486612 CCCACTCTAGAGAAGTGGGATGG - Intergenic
906507698 1:46392661-46392683 CCTTCCCTAGGGGAAGGGGAAGG - Intergenic
906626877 1:47332877-47332899 TCTTCCCTAATGAAGGGGGCAGG + Intergenic
908166160 1:61461541-61461563 CCTTTCCCAGATTAGGGGGATGG + Intronic
909774543 1:79467426-79467448 CCTGCCCTATACCAGGGGGAAGG - Intergenic
910712650 1:90197557-90197579 CCTTCCATGGGGAAGGGGGATGG + Intergenic
910808309 1:91210795-91210817 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
912980586 1:114368174-114368196 CCTCCCCTAGAGGAAGAGGAAGG - Intergenic
913957757 1:143320084-143320106 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914052067 1:144145448-144145470 CCTACCCCAGAGAAGGGGTATGG + Intergenic
914127130 1:144821093-144821115 CCTACCCCAGAGAAGGGGTATGG - Intergenic
914999387 1:152574186-152574208 CCCTGCAGAGAGAAGGGGGATGG + Intronic
915313106 1:155014271-155014293 CCTTCCAAAGAGATGGGGAATGG + Intronic
916669618 1:167002670-167002692 CCTTTACTAGAAAAGGGGGAAGG + Intronic
917642812 1:176999213-176999235 CCTTCTCCAGAGAAAGAGGATGG + Intronic
919108603 1:193188624-193188646 CCTTTCCTGGAGAAAGGGGTAGG - Intronic
920201699 1:204263457-204263479 CCTTCCCTGGGGAAGGGCCATGG + Intronic
920298160 1:204972399-204972421 CCTTTCTTAGAGTAGGGGAAAGG + Intronic
920366004 1:205448725-205448747 CCTTCCCTAGAGAATAAGGCCGG + Intronic
921005954 1:211093870-211093892 CCTACCCTATAAAGGGGGGAAGG + Intronic
922901125 1:229137503-229137525 CCTAACCTAGATATGGGGGAAGG - Intergenic
923034124 1:230272289-230272311 CCTTCCCCAGAGAAGGTGGCCGG + Intronic
923913759 1:238480087-238480109 CCTTCCATACAGGAAGGGGAGGG - Intergenic
1062959948 10:1565395-1565417 GCGTGCTTAGAGAAGGGGGAGGG - Intronic
1065810425 10:29438222-29438244 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1065948110 10:30625859-30625881 CCTCCCCTAAAGCAGGGGGATGG - Intronic
1066486596 10:35851905-35851927 ACTTCCCAAGAGGAGGGGCATGG + Intergenic
1066759917 10:38740515-38740537 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1066961700 10:42232254-42232276 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1067282904 10:44886402-44886424 CCTGCAGGAGAGAAGGGGGAGGG - Intergenic
1067347218 10:45445302-45445324 CCTTCCTTAGAGAAGCAGGTTGG + Intronic
1068556455 10:58464535-58464557 CCATACCTAGAGAAAGGGTATGG - Intergenic
1069342292 10:67425778-67425800 CCACTCATAGAGAAGGGGGATGG + Intronic
1070182858 10:74031245-74031267 CTTACCCTAGACAAGGGGGGTGG - Intronic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1073083712 10:100875244-100875266 TCTCCCCTAGAGAGGAGGGAAGG + Intergenic
1073255778 10:102150088-102150110 TCTCCCCTAGAGTAGGGGAAGGG - Exonic
1077398197 11:2336985-2337007 CCTTCCCTAGGGGAAGGGGAAGG + Intergenic
1078441122 11:11369302-11369324 CCTTCCCTAGAGGGTTGGGAGGG - Intronic
1081443500 11:43106610-43106632 CCTTCCCTAGAGTATTAGGAGGG + Intergenic
1083443140 11:62690028-62690050 TCTCCCCCAGAGGAGGGGGATGG - Intergenic
1084483456 11:69434945-69434967 CACTCCCTAGAGAAAGGGGCAGG + Intergenic
1085418809 11:76337987-76338009 CCTTCCCTGGAGTGGGAGGAGGG - Intergenic
1086151128 11:83612149-83612171 CCTGCCCTTGAGGAGGGGGTGGG - Intronic
1086993754 11:93333405-93333427 CCTTCCATAGGGAAGGAGAAAGG + Intronic
1087354195 11:97073900-97073922 CCTTGCCCAGTGAAGAGGGATGG + Intergenic
1087602785 11:100337986-100338008 AGTTCCCTAGAGAAGGGGCAAGG - Intronic
1088408384 11:109505973-109505995 GCTTACCTATAGAAGGGTGAGGG + Intergenic
1088930720 11:114348470-114348492 CCTTCCCTAGTAAAGGAGTAGGG + Intergenic
1088982301 11:114874773-114874795 GCTTCACTAGAGGAGGTGGAAGG + Intergenic
1089165405 11:116472140-116472162 CCCTCCCTAGAGCTGGGGGCTGG - Intergenic
1089956281 11:122574367-122574389 CCTGCCCCAGAGCAGGAGGATGG - Intergenic
1090083166 11:123627922-123627944 CCCTCCCGTGAGAAGGTGGATGG - Intergenic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091989589 12:4944220-4944242 CCTTCACTAGAGCAGGAAGAAGG - Intergenic
1092629536 12:10363279-10363301 CCTTCCCTAGGGAAAGGGGAAGG + Intergenic
1094038867 12:26102045-26102067 CCTTATCTATAGAATGGGGATGG - Intergenic
1095976727 12:47945286-47945308 AGTGCCCTAGAGAAGAGGGAGGG - Intergenic
1096258170 12:50075185-50075207 CCCTCCCTAGCGTAGGGGCAGGG + Intronic
1096577373 12:52561380-52561402 CCTTCCCCAGGGCAGGAGGATGG + Intergenic
1096833103 12:54329960-54329982 CTTTGCCCAGAGCAGGGGGAGGG - Intronic
1097503020 12:60430190-60430212 CCCTCCCAAGATAAGAGGGATGG - Intergenic
1102866929 12:116382066-116382088 CATTTCCTACAGGAGGGGGACGG - Intergenic
1102924798 12:116818666-116818688 CCTTCCCCAGAAAAAGAGGAAGG - Intronic
1103806221 12:123575228-123575250 GGTTCCCAAGAGAAAGGGGAGGG - Intergenic
1104015622 12:124959931-124959953 CCTGCCCTGGAGCAGGGGGAGGG + Intronic
1104040388 12:125126369-125126391 GCTTCCTTGGGGAAGGGGGACGG - Intronic
1104843569 12:131835698-131835720 CCTTCCCTGGTGAGGGGGCAGGG + Intronic
1107398777 13:40048145-40048167 CCCTCCCTTGAGAATGGGGATGG + Intergenic
1113918346 13:113888297-113888319 CCCTCCCTAGAGGTTGGGGATGG - Intergenic
1114724924 14:24925954-24925976 CCTTTCCTAGAAAACTGGGAAGG + Intronic
1114891967 14:26936265-26936287 CTTTCCCTCCAAAAGGGGGAAGG + Intergenic
1116479971 14:45385622-45385644 CCTTTCCAAAAGAAGGGAGATGG + Intergenic
1116798600 14:49418332-49418354 CCTTCCCAGGGGAAGGGGGTTGG + Intergenic
1117028587 14:51646929-51646951 CCTTCCCAAGAGCAAGGGGCAGG + Intronic
1117726195 14:58676838-58676860 CTCTCCCTAGAGAAGGGAAATGG - Intergenic
1118910403 14:70057518-70057540 CCATCCCTAGAGTAGTGAGAAGG + Intronic
1119050289 14:71361081-71361103 ATATCCCTAGTGAAGGGGGAAGG - Intronic
1120050773 14:79862954-79862976 CCTTTCCTAGGGAAGAGGAAGGG + Intronic
1120710211 14:87785697-87785719 CCTTCCCTAGGGCTGGGGGGTGG - Intergenic
1120878951 14:89399689-89399711 CCTTCCTTCTGGAAGGGGGAGGG + Intronic
1121102190 14:91257514-91257536 TCATCCTTAGAGTAGGGGGATGG - Intergenic
1121445657 14:93977255-93977277 TCTTCCCTAGACCAGGAGGAAGG - Intergenic
1122393619 14:101407469-101407491 CCTTGCCTGGAGAAGGCGGCTGG - Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1202930628 14_KI270725v1_random:30006-30028 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123421729 15:20141411-20141433 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123443333 15:20305125-20305147 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1123530955 15:21147951-21147973 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1123984646 15:25634450-25634472 CCTTCCCCCAAGAAAGGGGAGGG + Intergenic
1124657698 15:31522693-31522715 CCTTCCCTAGGGCTTGGGGAGGG - Intronic
1128346334 15:66854738-66854760 CATTCACTGGGGAAGGGGGAGGG + Intergenic
1129327226 15:74807158-74807180 CCTTCCTTAGAGCAGGGGGTGGG + Intergenic
1129808056 15:78481138-78481160 CTGTCCCTAGAGAAAGGGGATGG + Intronic
1131324839 15:91432235-91432257 TCTTCCCTGGAGAAGGTGGGTGG + Intergenic
1131341183 15:91602609-91602631 AATTCCATAGAGAAGTGGGATGG - Intergenic
1131392001 15:92057250-92057272 GCTGCCCTAGGGAAGGGGCATGG - Intronic
1133470971 16:6075056-6075078 CTTTCACTAGAGAAGCTGGATGG + Intronic
1134256730 16:12618599-12618621 TCTGCCCCAGGGAAGGGGGAAGG + Intergenic
1134536902 16:15033643-15033665 CCTGCCTTAGAGAAGAGGGCGGG + Intronic
1136722886 16:32338762-32338784 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136841207 16:33544761-33544783 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1136863114 16:33714246-33714268 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1138186573 16:54982039-54982061 CCTTCCCTAGAGCCGGGGGCAGG + Intergenic
1139307773 16:66002283-66002305 CCTTCCTAATAGAAGGTGGAAGG + Intergenic
1139923710 16:70474507-70474529 GCCTGCCAAGAGAAGGGGGAGGG - Exonic
1140240128 16:73192766-73192788 CCGTCCTCAGAGAAGGTGGAAGG + Intergenic
1140950597 16:79813199-79813221 CCATCCCAAGACAAGGAGGATGG + Intergenic
1142016771 16:87753031-87753053 CCTTCCCTGGAGCAGGGACAAGG + Intronic
1203003545 16_KI270728v1_random:179002-179024 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203124600 16_KI270728v1_random:1562399-1562421 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203135153 16_KI270728v1_random:1715409-1715431 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1203151372 16_KI270728v1_random:1845058-1845080 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1142471026 17:163350-163372 CCTTCCCTAGAGAAGGGGGAAGG + Intronic
1144196265 17:12898057-12898079 CCTCCCCAAGAGAAGGGGACAGG + Intronic
1145066713 17:19766399-19766421 GCTTCCCTTAAGAAGGGAGATGG + Intergenic
1146957763 17:36946724-36946746 CCTTCTCCAGAGAAGGCGGAGGG - Intergenic
1147428235 17:40356347-40356369 CCTTCCCTGGGGGACGGGGAGGG + Exonic
1148536392 17:48442587-48442609 ACTTACCTAGAGAAGTTGGAAGG - Intergenic
1148830825 17:50429908-50429930 CCTTCCCCAAAGAAGGTGGATGG + Intronic
1149292972 17:55235208-55235230 CCTTTCCTAGAAAAGCAGGATGG - Intergenic
1149483523 17:57023166-57023188 CCTCCCCTAGAGATGGGGGTGGG - Intergenic
1149629494 17:58110558-58110580 CTCTCCCTAGAGAACAGGGAAGG - Intergenic
1149932445 17:60769556-60769578 CCTGCCGTGGGGAAGGGGGAGGG + Intronic
1151561343 17:74871541-74871563 CCTTCACAGGGGAAGGGGGAGGG + Intronic
1151716950 17:75835826-75835848 CATGCCCTAGAGACGGGGGAGGG + Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1151963454 17:77419407-77419429 CCCACCCTAGGGAAGCGGGAGGG - Intronic
1151963490 17:77419531-77419553 CCAGCCCTGGGGAAGGGGGAGGG - Intronic
1152934814 17:83130007-83130029 CCTTCCCGAGAGTATGGAGAGGG - Intergenic
1153038360 18:786327-786349 TCCTCCCTAGAGTAGGAGGAAGG + Intronic
1153685321 18:7539054-7539076 CCTTTCCTCGAGATGAGGGAGGG + Intergenic
1155280564 18:24235401-24235423 CTTTCCCAAGAGTAGGGGAATGG + Intronic
1155415797 18:25598000-25598022 CCTGCTCTAGAGAAGGAGGCAGG - Intergenic
1156442125 18:37201004-37201026 CCATCCCAAGTCAAGGGGGAAGG + Intronic
1157396148 18:47343271-47343293 CCTTCCCCAGAGGATGAGGATGG + Intergenic
1157692323 18:49693630-49693652 CACTCCCTAGAGATGGTGGAGGG - Intergenic
1160784888 19:895563-895585 CCTCCCCTAGAGACGCTGGAGGG + Intergenic
1161300922 19:3542951-3542973 TCTTGCCTGGAGAAGAGGGAGGG - Intronic
1161505287 19:4640348-4640370 CCTTCTCTATGGAGGGGGGAAGG + Intronic
1162340107 19:10086856-10086878 CGGTGCCTAGAGATGGGGGAGGG + Intronic
1162493268 19:11007847-11007869 CATCCCCCAGAGAGGGGGGACGG - Intronic
1163190400 19:15673050-15673072 CCTTCCCTAGATCAGGGGCCAGG + Exonic
1163807959 19:19411425-19411447 CCTTCCTTAGAGAACTGAGAGGG + Intronic
1164526533 19:29017321-29017343 CCCTCCATGGAGAAGGAGGATGG - Intergenic
1164690316 19:30206097-30206119 CCTTCTCTATAAAATGGGGATGG - Intergenic
1166129394 19:40736974-40736996 CCTGCCCTACAGAAGGCAGATGG + Exonic
1166171528 19:41030719-41030741 TTTTCCTTTGAGAAGGGGGAAGG + Intergenic
1166297868 19:41897510-41897532 CCTTCCCTGAGGCAGGGGGATGG - Intronic
1166920775 19:46227539-46227561 CCTTCCCCAGGGCAGGGGCAAGG - Intergenic
1167643857 19:50695445-50695467 CCTTGGCGGGAGAAGGGGGAGGG + Intronic
1168369259 19:55818171-55818193 CCTTCCCTGGAGAAGCAAGATGG - Exonic
1202691466 1_KI270712v1_random:97872-97894 CCTACCCCAGAGAAGGGGTATGG + Intergenic
926634078 2:15162286-15162308 GCTTCACTAGTGAAAGGGGAGGG - Intergenic
927207210 2:20618207-20618229 CCTTTCCTGGGAAAGGGGGAAGG + Exonic
928012553 2:27623750-27623772 CCTTCACTAGAGAGAGTGGAGGG - Intergenic
928595240 2:32853830-32853852 TCTCCCCTAGAGAAGGTGTAAGG - Intergenic
933149870 2:78901628-78901650 CCCTCCCCAGAGGATGGGGATGG + Intergenic
933748085 2:85585098-85585120 CCTCCCCTAGAGAAAGAGAAAGG + Intronic
933762733 2:85683907-85683929 TCCTCCCTAGGGAAGGAGGAAGG + Intergenic
933954925 2:87356078-87356100 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934239114 2:90252292-90252314 CCTACCCCAGAAAAGGGGTATGG - Intergenic
934274069 2:91564406-91564428 CCTACCCCAGAGAAGGGGTATGG + Intergenic
934323240 2:91984855-91984877 CCTACCCCAGAGAAGGGGTATGG - Intergenic
934461554 2:94215646-94215668 CCTACCCCAGAGAAGGGGTATGG - Intergenic
935679307 2:105622165-105622187 AGTTCCCTAGAGCAGGGGGCAGG + Intergenic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
937399238 2:121567313-121567335 GCTTCCCAAGAATAGGGGGAAGG + Intronic
937952993 2:127402510-127402532 CCTTCCCCATAAAAGGGGGTGGG - Intergenic
938155771 2:128938825-128938847 CCCTCCCAAGAGAAGGCAGAAGG - Intergenic
938702967 2:133895352-133895374 CCTTCCCTAGGGGAAGAGGAAGG + Intergenic
939026165 2:137015884-137015906 CCTTTCCTCGAGAGGAGGGAGGG + Intronic
942191353 2:173473625-173473647 TCTGCCCTAGAGAGGTGGGATGG + Intergenic
943393739 2:187305769-187305791 CCTTACCTAGAGAAAGAGGAAGG - Intergenic
945041227 2:205745397-205745419 CTTTGGCTAGAGAGGGGGGAAGG - Intronic
945054588 2:205857407-205857429 CCTTCCCTAGAGCAGATGGCAGG + Intergenic
946313098 2:218893604-218893626 CCTTCCCTGGAGATGGGAGGTGG + Exonic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947556556 2:231098637-231098659 CCTCCCCTAGAGGAAGTGGAAGG - Intronic
948496516 2:238353406-238353428 CCATCCTTAGAGGAGGGGGAGGG + Intronic
948703284 2:239774130-239774152 CCTTGCCTGGAGAAGGGGCCAGG + Intronic
948764039 2:240210464-240210486 CCCTCCATAGAGAACGGGGCTGG - Intergenic
1169235231 20:3925168-3925190 GTTTCTCTAGAGTAGGGGGAGGG - Intronic
1169255188 20:4091651-4091673 AATTCCCTAGAGAAGAGAGAAGG - Intergenic
1170958124 20:21000475-21000497 CCCTCCCAAGAGAAGGGAAAAGG + Intergenic
1171115798 20:22523909-22523931 CCTTCCCTGGAGCAGGCTGAAGG + Intergenic
1172006172 20:31820242-31820264 CCTGCCTCAGAGAAAGGGGATGG + Exonic
1172838137 20:37886215-37886237 CTTTCCCTAGAGAGGTGGGAGGG + Intergenic
1174161910 20:48557120-48557142 CCTTCCCTGGAGGAAGGGGAGGG - Intergenic
1174612738 20:51812264-51812286 TCTTCCCTAGTCAATGGGGAGGG + Intergenic
1175787021 20:61718187-61718209 CCTTCCCCAGGGCAGGGTGAAGG + Exonic
1176592641 21:8658607-8658629 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1178836863 21:36105520-36105542 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1178912029 21:36682783-36682805 CCTGCACTAGAGATGGGTGAAGG - Intergenic
1179723317 21:43328314-43328336 CAATCCCTGGAGAAGGGGGCTGG + Intergenic
1179824064 21:43954220-43954242 CCCTCCCTGCAGAAGGGTGACGG - Intronic
1179924562 21:44527244-44527266 GCTTTCCAAGAGAAAGGGGATGG + Intronic
1180244424 21:46537562-46537584 ATTTCCCTAAAGAAGGGTGAAGG - Intronic
1180275497 22:10635749-10635771 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1180549985 22:16530726-16530748 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1181354693 22:22291110-22291132 CCTACCCCACAGAAGGGGTATGG + Intergenic
1181725069 22:24806002-24806024 CCCGCCCTAGGGAAGAGGGAGGG + Intergenic
1181911972 22:26245427-26245449 CCCTCCCTAGAGGAGGGAGAAGG - Intronic
1182278816 22:29206436-29206458 CTTTCCCAAGTGCAGGGGGAGGG - Intronic
1184043208 22:41956711-41956733 CCTCCCCTATGGAAGGGGAAAGG - Intergenic
1184059785 22:42074651-42074673 CCTTCCCCAGACGCGGGGGAGGG + Intronic
1185314344 22:50172289-50172311 CCTTTCCTAGAGCTGTGGGAGGG - Intronic
950597539 3:13997523-13997545 GCTTCCCTTGGGTAGGGGGAGGG + Intronic
950610433 3:14123669-14123691 TCTGCGCCAGAGAAGGGGGATGG - Intronic
950790984 3:15471823-15471845 CATTCCCTAGAGAATGTTGAAGG - Intronic
953141397 3:40232381-40232403 GCTTCTCTAGTGAAGTGGGAGGG + Intronic
953268304 3:41414830-41414852 CCTTCTCAAGAGAAAGGGGACGG - Intronic
954106555 3:48412684-48412706 CATGCCCTGGAGAAGGGGCAGGG + Intronic
954298026 3:49684950-49684972 GCTTGCCTGGGGAAGGGGGAAGG + Intronic
954604487 3:51898096-51898118 CCTCCCCTAGGGGAAGGGGAAGG + Intronic
954617779 3:51978384-51978406 GCTTCCCTAGACAAAGGGGTGGG - Intronic
954864516 3:53717546-53717568 CCTACCATGGAGAAGTGGGATGG + Intronic
955043381 3:55337583-55337605 CCTTCCCAAGGGAACAGGGATGG + Intergenic
956451264 3:69377627-69377649 GCTACCCTTGAAAAGGGGGATGG - Intronic
957265951 3:77966105-77966127 CCTGTCCTGGAGTAGGGGGAAGG + Intergenic
957965898 3:87322038-87322060 CTTTCCCTGGGGAAAGGGGAAGG + Intergenic
959495749 3:107049339-107049361 GCTTCCCAGGAGAAGAGGGAAGG - Intergenic
961435375 3:126912905-126912927 CCTTCCCTGCAGAAGGCCGAGGG + Intronic
962336355 3:134534986-134535008 CCTTGGGTAGAAAAGGGGGAGGG - Intronic
963060629 3:141222048-141222070 CCTGGCCTGGAGAAGAGGGAAGG - Intergenic
965345238 3:167540471-167540493 CCATCCCTAGGGGAAGGGGAAGG + Intronic
966911699 3:184563318-184563340 CCTTCCCTAAAGTGGAGGGAGGG + Intronic
966977126 3:185094511-185094533 CCTTCCCTTGCCAAGGGAGACGG + Intronic
967217390 3:187222059-187222081 CCTTCCCTGGATAAGGGGAGAGG + Intronic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
968754012 4:2405586-2405608 CCTTCCCTAGGTCAGAGGGAAGG + Intronic
970322494 4:14888579-14888601 CCTCCTCTAGAGAATGAGGATGG - Intergenic
972784748 4:42315793-42315815 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
974809741 4:66930730-66930752 CTTTCCCTAGAGAGGAGGAATGG + Intergenic
975951113 4:79772268-79772290 CCATCCCTAGGGAAAGGGGGAGG + Intergenic
976248923 4:83031211-83031233 TCTTCCCTAGGGAGGGAGGAAGG + Intergenic
976995465 4:91426957-91426979 CCTCACCTAGAAAATGGGGATGG - Intronic
977319540 4:95495229-95495251 CATTCCCAAGAGAAGGGAGTGGG - Intronic
977854753 4:101875995-101876017 CCTTTCCTAAAGCAGAGGGAAGG - Intronic
978232133 4:106412446-106412468 CCTTCTCCAGAGAGGGGAGAGGG - Intergenic
978313937 4:107415144-107415166 CCTCCCCTAGGGTAAGGGGAAGG + Intergenic
978789145 4:112642747-112642769 CCTTCCCTAGATAAGGACCATGG + Intronic
979403970 4:120286129-120286151 GCTTCCCTAGAGATGGTGGCAGG - Intergenic
979434706 4:120674309-120674331 CCTTCCCCTAAGAATGGGGAAGG - Intergenic
981001732 4:139834829-139834851 CCTTTCTGGGAGAAGGGGGAGGG + Intronic
981812253 4:148789311-148789333 CCTTCCATAGGGCAGCGGGAGGG + Intergenic
983524213 4:168744028-168744050 CCTTCCCTGGAAAAGGGGTCGGG + Intronic
983873634 4:172851058-172851080 CCTTCTCCAGAGAATGGGGGTGG + Intronic
984425553 4:179580810-179580832 GCATTCCTAGGGAAGGGGGATGG - Intergenic
986603790 5:9501581-9501603 CCTTCTCTTGAGTAGGGGAAGGG - Intronic
987503415 5:18742707-18742729 CCCTCCCTAGTAAAGGGGTAGGG + Intergenic
987891265 5:23881619-23881641 CCCTCCCTTGAAAAGGGGGATGG - Intergenic
988069284 5:26266470-26266492 CACTCCCTAGGGAAGGGGTAAGG - Intergenic
989346028 5:40430452-40430474 CCTTGCCTAGGGAAAGGGGCAGG + Intergenic
989503849 5:42202625-42202647 GCTTGCTTAGAGAAGGGGCAAGG + Intergenic
989682616 5:44046795-44046817 CCTTGCCTAGTGAGGAGGGATGG + Intergenic
991325669 5:65429092-65429114 GCTTCAGTAGAGAAGGGGCAAGG - Intronic
991497429 5:67240974-67240996 CTTTAGCTAGAGCAGGGGGAGGG + Intergenic
992712771 5:79476939-79476961 CCTTCTCTAGAGTATGGGGTAGG + Intronic
992716291 5:79514185-79514207 CCTTCCCGCGAGCAGAGGGAGGG - Exonic
993055418 5:82974795-82974817 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
994252736 5:97555928-97555950 CCTGGCCTAGACAAGGGGGCAGG - Intergenic
997384226 5:133459852-133459874 CTTTGCCTAGGGAAAGGGGAGGG - Intronic
998227548 5:140338669-140338691 GCTTCCCCAGAGAAGGAGGGGGG + Intronic
998251850 5:140558678-140558700 CCCTCCTTTGAGCAGGGGGAGGG + Exonic
998552789 5:143093741-143093763 CCTCCCCTAGGGGAAGGGGAAGG - Intronic
998962942 5:147508465-147508487 CATTACCTAGACAAGGGTGAGGG + Intronic
1001651643 5:173320184-173320206 CTTTCCCCAGAGTAAGGGGAGGG + Intronic
1001780080 5:174360880-174360902 CCTGCCCTAGTCAAGGGGCAAGG + Intergenic
1002830001 6:811677-811699 CCTTTAATAGAGAAGGGGGTAGG + Intergenic
1004062014 6:12206801-12206823 CCTTCCCTAGGGAAGGCAGCTGG + Intergenic
1006065791 6:31461874-31461896 TCTTCCCCAGAGGATGGGGATGG - Intergenic
1006518462 6:34557420-34557442 CATTCCCCAGAGAAGGTTGAGGG + Intergenic
1007662644 6:43496114-43496136 CCCTCTGTAGAGAAGGGGAAAGG + Intronic
1007795374 6:44342800-44342822 CCTCCCCTGGGGAAGGGGGTGGG + Exonic
1007811827 6:44491752-44491774 CCTTCTCCAGAGATGGGGGTGGG - Intergenic
1007811836 6:44491759-44491781 CCATCTCTGGAGAAGGGAGAGGG + Intergenic
1008109748 6:47478600-47478622 CCATCCCACGAGGAGGGGGAGGG - Intronic
1010733145 6:79412091-79412113 CGTTCCCTGAAGAAAGGGGAAGG + Intergenic
1011146802 6:84227213-84227235 TCTTCTGTAGAGATGGGGGAGGG + Intronic
1011490840 6:87890263-87890285 CCTTCCCTGGAGACTGGGGCAGG + Intergenic
1011570127 6:88725807-88725829 CCTCCCCTAGGGGAAGGGGAAGG + Intronic
1011882223 6:92043401-92043423 CCTTCAATAGGGATGGGGGAAGG - Intergenic
1013157956 6:107511726-107511748 CCTTCTCCAGAGAAAAGGGAGGG - Intronic
1013317668 6:108957587-108957609 CCTTCCCTAGTCATGTGGGAAGG + Intronic
1014016521 6:116537139-116537161 CTTACACTAGAGAAGGGTGAAGG + Intronic
1015972344 6:138754772-138754794 CCTTCTCTAAAAAAGAGGGATGG + Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1018191616 6:161314367-161314389 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1019417054 7:932603-932625 CCTTCCCTAAAAAATGGGCAGGG - Intronic
1019644304 7:2120919-2120941 CCTGCCCTAGAGCAGGTGCAGGG - Intronic
1019686985 7:2387406-2387428 CCTTTCCCAGAGAATTGGGAGGG - Intergenic
1020598850 7:10247707-10247729 CCTCCCCTAGACAAGGGAGATGG + Intergenic
1023436644 7:40147154-40147176 CCTCCCCTAGCGGAAGGGGAAGG - Intronic
1024045418 7:45582491-45582513 CCTTCCTTAGGGAAGGGAGTGGG + Intronic
1024842467 7:53603187-53603209 CCTTGCCTAGTGAAGGGGAGTGG - Intergenic
1025255424 7:57381362-57381384 CCTTCCCAGGAGAAGTGGGGTGG + Intergenic
1026933757 7:74239872-74239894 CCTTCCCCATGGAAGGGGCATGG + Intronic
1032046072 7:128609535-128609557 TCTGACCTAGAGAAGAGGGAGGG + Intergenic
1032127089 7:129203105-129203127 CCGTCCCTAGAGTAGAGGGCTGG + Intronic
1032141279 7:129332805-129332827 CCTTCCCTAGAGGAAGGGAAAGG + Intronic
1032168146 7:129561978-129562000 TCTTCCCTGGGGAAGAGGGAGGG + Intergenic
1032746068 7:134787539-134787561 CCTGCCCTAGAGAAGATGTAGGG - Intronic
1033081879 7:138306341-138306363 CCCTCCCCAGAGTAGGGGGATGG + Intergenic
1033807866 7:144975307-144975329 CCTTCCCATGAGAAGCAGGATGG + Intergenic
1034552946 7:151832780-151832802 TATTACCTAGAGAAGAGGGAGGG - Intronic
1035165805 7:156989066-156989088 CCTTCCCCAGAGCAGGAGGGAGG - Intergenic
1036728706 8:11243129-11243151 AGTTCCCAAGAGAAGGGGCAAGG + Intergenic
1038382143 8:27106046-27106068 CCTTCCCCAGAGTAGGCCGAGGG - Intergenic
1038447102 8:27611789-27611811 CCTTCCCCAGAGATGGGGTAGGG + Intronic
1039899299 8:41740045-41740067 GCTGCCACAGAGAAGGGGGAAGG - Intronic
1041606870 8:59792446-59792468 CCTTTCCTCAAGAAGAGGGAAGG - Intergenic
1042330964 8:67580184-67580206 CTTGCATTAGAGAAGGGGGAGGG - Intronic
1042579022 8:70256134-70256156 CCTTCCCTAGCAAGAGGGGAAGG + Intronic
1044184894 8:89239708-89239730 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1044729838 8:95220881-95220903 CCTTCCTCAGAGAAGGGGGCAGG - Intergenic
1047572107 8:126110379-126110401 CCCTTCCCAGAGAAGGGGGTGGG - Intergenic
1047842476 8:128767687-128767709 CCATCCCTAGGGGAAGGGGAAGG + Intergenic
1048046390 8:130777174-130777196 CCTTGCCTAGAGATTGGGCAAGG - Intergenic
1048859236 8:138711663-138711685 CCAGCCCCAGAGAAGGAGGATGG + Intronic
1048868133 8:138775910-138775932 CTTTCCATAGAAAAGGGAGAGGG - Intronic
1049255993 8:141614191-141614213 TCTTCCTTGGAGCAGGGGGAGGG + Intergenic
1051323831 9:15942433-15942455 CCTTCCCTTAAGAAAGGGGCAGG - Intronic
1053692030 9:40591299-40591321 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054272770 9:63046186-63046208 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1054303287 9:63392265-63392287 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054402066 9:64718775-64718797 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054435672 9:65203090-65203112 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1054494721 9:65818597-65818619 CCTACCCCAGAGAAGGGGTATGG + Intergenic
1056104411 9:83332817-83332839 CCATCCCTAGCTAAGTGGGAGGG + Intronic
1056309537 9:85324943-85324965 CTATCCCTAGAGAAGTGGGGAGG + Intergenic
1056603451 9:88065253-88065275 ACTGCCCTAGAGGAGGGGGTGGG - Intergenic
1056850469 9:90079713-90079735 CCTTCCCAAGAGAAAGATGAAGG + Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1057606263 9:96499629-96499651 CTTACCCTACAGAAGGGGGCTGG + Intronic
1058230772 9:102421059-102421081 CCATCCCTAGTTAAAGGGGAGGG - Intergenic
1059992789 9:119881089-119881111 TCTTGCCTGGGGAAGGGGGATGG - Intergenic
1060494916 9:124111538-124111560 GCTCCCCTGGAGGAGGGGGATGG - Intergenic
1060992024 9:127854720-127854742 GCTTCCTTAGAGAAGGGGCTGGG + Exonic
1061083863 9:128387914-128387936 CCTTCCCTGAAGCAGGTGGAGGG + Intronic
1061546617 9:131308325-131308347 CTGGCCCTAGAGAAGGGGCAGGG + Exonic
1061747948 9:132753722-132753744 CCTTCCCTAGAGAACATGGAGGG - Intronic
1062163593 9:135093755-135093777 CCTTCCCTAGGGTTGGGAGATGG + Intronic
1062219826 9:135409215-135409237 CCACCCCAGGAGAAGGGGGAAGG + Intergenic
1203622693 Un_KI270749v1:137435-137457 CCTACCCCAGAGAAGGGGTATGG - Intergenic
1185523870 X:761892-761914 CCTCCCCTAGAGACTGTGGAGGG - Intergenic
1186487630 X:9945955-9945977 CCTCACCTGGAGAAAGGGGAAGG - Intronic
1186714730 X:12239529-12239551 CATTATCTAGAGAAGGGAGAGGG + Intronic
1187180244 X:16937082-16937104 CTTTCCTTAGAGAAGAGTGAGGG + Intergenic
1187636875 X:21238698-21238720 CTTTGCCTAGAGAAAGGGGAAGG + Intergenic
1187668290 X:21640577-21640599 CCTCCCTTAGAAAATGGGGAGGG - Intronic
1188239581 X:27768931-27768953 GCTTCACTAGAGACAGGGGAGGG + Intergenic
1188745119 X:33831656-33831678 CCTTCACCAGATGAGGGGGAGGG + Intergenic
1189388550 X:40557130-40557152 CCTCCCCTAAGGAAGGGTGAGGG - Intergenic
1191890132 X:65931572-65931594 CCTCCCCTAGGGGAAGGGGAAGG - Intergenic
1192178351 X:68899666-68899688 TCTTCCCAAGAGAAGGAGGTGGG + Intergenic
1192270196 X:69571893-69571915 ACTTCCTTAAAGAAGGGGAAGGG - Intergenic
1192372884 X:70529731-70529753 CCTTTCCTAGCCAAGGAGGATGG + Intronic
1192657027 X:73003153-73003175 CCTTCCCGCGAGCTGGGGGACGG - Intergenic
1192665093 X:73079848-73079870 CCTTCCCGCGAGCTGGGGGACGG + Intergenic
1198019306 X:132642708-132642730 CCTTAGCTAGAGAGGTGGGATGG - Intronic
1198886252 X:141341826-141341848 CCTTTCCTTGGGAAGAGGGAAGG - Intergenic
1199537727 X:148922288-148922310 CCATCCCTAGAGTCAGGGGAAGG + Intronic
1199637513 X:149827161-149827183 CCTCCCCTAGGGAAAGGGGAAGG + Intergenic
1199713352 X:150488127-150488149 CTTCCCAGAGAGAAGGGGGAGGG - Intronic
1200115455 X:153767931-153767953 CCATCCACAGAGAGGGGGGATGG - Intronic
1201190663 Y:11439843-11439865 CCTACCCCAGAGAAGAGGTATGG - Intergenic
1201900136 Y:19040679-19040701 CCTCCTCTAGAGGAAGGGGAAGG - Intergenic