ID: 1142473110

View in Genome Browser
Species Human (GRCh38)
Location 17:174065-174087
Sequence TCTTGGGTCTGCAGGGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 219}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142473105_1142473110 -6 Left 1142473105 17:174048-174070 CCAGGCATAACAAAGTTTCTTGG 0: 1
1: 0
2: 1
3: 9
4: 120
Right 1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG 0: 1
1: 0
2: 0
3: 19
4: 219
1142473104_1142473110 -5 Left 1142473104 17:174047-174069 CCCAGGCATAACAAAGTTTCTTG 0: 1
1: 0
2: 1
3: 13
4: 197
Right 1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG 0: 1
1: 0
2: 0
3: 19
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142473110 Original CRISPR TCTTGGGTCTGCAGGGAAAT TGG Intronic
900490778 1:2948149-2948171 TCCTGGGTCTGCTGGAAACTGGG - Intergenic
902086341 1:13865781-13865803 TCTTGGGTCCTCAGTGAATTTGG + Intergenic
903745764 1:25585693-25585715 CCTTGGGTCTGCTGGGATGTCGG - Intergenic
904408162 1:30307335-30307357 TTTTTGGGCAGCAGGGAAATAGG - Intergenic
906097439 1:43233914-43233936 TCTTGGCTCTAAAGGGATATGGG + Intronic
906908958 1:49925704-49925726 CCTTGGATCTGAAGTGAAATTGG + Intronic
911945102 1:104097145-104097167 TCTTTGTTCTCCAGGGAACTTGG - Intergenic
912548897 1:110471566-110471588 ACTGGGGGCTGCAGGGAAGTGGG - Intergenic
914347015 1:146808621-146808643 GCTTGGCTCTGAAGGGAGATGGG + Intergenic
916948427 1:169754939-169754961 GCTTGGGTCTTCAGCAAAATTGG + Intronic
917016066 1:170532314-170532336 TCTTGGGTCTTAAGGGGAAGAGG + Intronic
918304339 1:183232354-183232376 TCTTCTGTCTGAAGGGAAGTTGG - Intronic
918807890 1:189073075-189073097 TCTTTGTTCTGCAGGAAAAAAGG + Intergenic
919430969 1:197491229-197491251 TCTATGTTCTCCAGGGAAATTGG - Intergenic
920913268 1:210237018-210237040 CCTTGGGCCTGCAGGGAGATGGG - Intronic
921310059 1:213833668-213833690 TTTAGGGTCTGAAGGGAGATAGG + Intergenic
923920449 1:238558599-238558621 TCCTGGGTCTGCAGGTCAGTGGG + Intergenic
1062777001 10:159373-159395 TCTACAGGCTGCAGGGAAATAGG - Intronic
1063330642 10:5155616-5155638 TCTGTAGTATGCAGGGAAATGGG - Intergenic
1066011609 10:31199547-31199569 CCTTGGGACTTTAGGGAAATTGG + Intergenic
1066974205 10:42349881-42349903 TGTTGGGTCCCCAGGGTAATGGG - Intergenic
1067476712 10:46572289-46572311 TCTTGGGACTGCGGGGACAGTGG - Intergenic
1067618025 10:47769491-47769513 TCTTGGGACTGCGGGGACAGTGG + Intergenic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1070157994 10:73848120-73848142 TCTTGGTTCCTCAGGGAAGTAGG - Intronic
1070874370 10:79788760-79788782 TCTGGTGTCTGTAGGGAAAATGG + Intergenic
1073808600 10:107127532-107127554 TCTTAGGACAGCAGGGAAATGGG + Intronic
1074288284 10:112119093-112119115 TCTTGGGCCTGCAGAGAGAAGGG + Intergenic
1074374379 10:112927217-112927239 TCTTGTGTCTGGAGGGCAATTGG + Intergenic
1075799174 10:125142110-125142132 TCTTGGGTTTGCAGGGGACGGGG + Intronic
1076367085 10:129928078-129928100 TCTTGAGTTTGCAGGGCAAGTGG - Intronic
1078131742 11:8619334-8619356 TCCTGGGGATGCAGGGAAATAGG + Intronic
1079777072 11:24544920-24544942 TGTTGGGTTTGCAGAGAAAAAGG - Intronic
1080614521 11:33934579-33934601 TCTGGTATCAGCAGGGAAATGGG + Intergenic
1081788799 11:45768115-45768137 TCATGGGTCTGCAGGTTAGTTGG + Intergenic
1082124709 11:48418498-48418520 GTTTGTGTCTGCAGGGAAGTAGG + Intergenic
1082251347 11:49984269-49984291 GTTTGTATCTGCAGGGAAATAGG - Intergenic
1082558366 11:54589738-54589760 GTTTGTGTCTGCAGGGAAATAGG + Intergenic
1083375313 11:62215588-62215610 CCTTAGGTGTGGAGGGAAATGGG - Intergenic
1084379870 11:68804974-68804996 TCTTGGTACTGCAGGGCATTGGG + Intronic
1087495898 11:98890542-98890564 TCTGGGGTCTGGAGGACAATGGG + Intergenic
1087831693 11:102826008-102826030 TCTGGGGTCTGCAGGACAGTGGG + Intergenic
1088070706 11:105780792-105780814 ACTTTAGTCTGCAGGGAACTTGG + Intronic
1089968807 11:122675830-122675852 TCTTGGAACTGCAGGGTATTTGG + Intronic
1090324163 11:125870481-125870503 CCTTAGGTGTGGAGGGAAATGGG + Intergenic
1090748128 11:129723479-129723501 TGTTGGGGCTGCAGGGACAGTGG - Intergenic
1090962896 11:131572955-131572977 TCTGGAGGCTGCAGGGAAATGGG - Intronic
1093840668 12:23895836-23895858 TCTTGCGTCAGCAGAGAAACTGG + Exonic
1094409703 12:30156132-30156154 TCTGGGGTCTCCAGGAATATGGG + Intergenic
1095089536 12:38090983-38091005 TCTTGGGTGAACAGGCAAATGGG - Intergenic
1095310478 12:40692400-40692422 TATTGGGGCAGCAGGGAAAGTGG - Intergenic
1096843534 12:54392842-54392864 CCTGGGTTCTGGAGGGAAATTGG + Intergenic
1098695593 12:73550243-73550265 TACTGGGGCTGCAGGGAAACTGG + Intergenic
1099383286 12:81981948-81981970 GCTAGGGTTTGAAGGGAAATAGG + Intergenic
1101128700 12:101666294-101666316 TCTTGGGTCCCCAGGGAACACGG - Intronic
1101861802 12:108488522-108488544 TGATGGGGCTGCAGGGAAAAGGG + Intergenic
1102324429 12:111967554-111967576 TTTTGGATATTCAGGGAAATTGG - Intronic
1105229821 13:18481662-18481684 TGTTGGGTCCCCAGGGTAATGGG - Intergenic
1105728112 13:23185865-23185887 TCTTGGTTCTGAAGGGTGATGGG + Intronic
1106849812 13:33777807-33777829 ACCTGGCTGTGCAGGGAAATGGG - Intergenic
1108165268 13:47686613-47686635 TCCTGCCCCTGCAGGGAAATAGG - Intergenic
1108426923 13:50312050-50312072 TCTTGATTTTGCAGGAAAATGGG + Intronic
1113339092 13:109404589-109404611 TCCTGAGACTGCAGGGACATGGG - Intergenic
1114014069 14:18408499-18408521 TGTTGGGTCCCCAGGGTAATGGG - Intergenic
1116183752 14:41569570-41569592 TTTTGGGGATGCAGGGAAATAGG + Intergenic
1116997192 14:51336182-51336204 TCTGGGTTCTGCAGGAAAAAAGG + Intergenic
1117535276 14:56697065-56697087 TCTTGGCTCTGGAGGGAGCTCGG - Intronic
1118156388 14:63246337-63246359 TCTAGAGTGTTCAGGGAAATTGG + Intronic
1118305649 14:64652919-64652941 TCTTGGGGCTTCAGGGTAAGTGG - Intergenic
1119030397 14:71187921-71187943 TCTGGGGTCTGCAGAGGAAGTGG + Intergenic
1121962583 14:98275059-98275081 GCATGGGTCTGCAGGGAAAGGGG - Intergenic
1122421174 14:101578593-101578615 TTTTGGGAGGGCAGGGAAATGGG - Intergenic
1122773111 14:104105900-104105922 CCTGGGGTCTGCAGGGGGATGGG + Intronic
1125519199 15:40338895-40338917 TCTTTGTTCTGCAGGAAAAGCGG - Exonic
1126493798 15:49268040-49268062 TGGTGGGTTAGCAGGGAAATGGG + Intronic
1129889601 15:79063067-79063089 ACTTCCATCTGCAGGGAAATGGG - Intronic
1132117159 15:99145844-99145866 CCTGGGCTTTGCAGGGAAATGGG + Intronic
1132394783 15:101464654-101464676 TGCTGGGAATGCAGGGAAATGGG + Intronic
1132647656 16:1006589-1006611 TCTTGGGACTGAAGGGACACTGG + Intergenic
1133038434 16:3047039-3047061 CCTGGGGTCTGCAGAGAGATTGG + Intronic
1133127875 16:3657891-3657913 GCTTGGGCCTGCAGGCAAGTGGG - Exonic
1133236916 16:4391826-4391848 TCTTGGGGCTGCAGGGTAGCAGG - Intronic
1133343054 16:5050702-5050724 TCTAGGTTCATCAGGGAAATCGG - Intronic
1137622734 16:49886855-49886877 TATAGGGTGTGCAGGGAAAATGG - Intergenic
1137649039 16:50103134-50103156 CCTTGAAGCTGCAGGGAAATAGG - Intronic
1138026942 16:53529237-53529259 TCTTTGATTTCCAGGGAAATTGG + Intergenic
1139632915 16:68241327-68241349 TCTCGGGGCTGCAGGGAGACTGG + Intergenic
1139650513 16:68359873-68359895 TCTTGGGGCTGGAGGCAGATCGG + Exonic
1139986969 16:70906649-70906671 GCTTGGCTCTGAAGGGAGATGGG - Intronic
1140049219 16:71464782-71464804 TCTTGGGGCTGCAGGGACAAAGG - Intronic
1140448945 16:75054491-75054513 CATAGGGTCTGCAGGGAAGTGGG + Intronic
1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG + Intronic
1141387217 16:83632872-83632894 TCTTGGGTTTTCCGGGAAAGGGG + Intronic
1141944739 16:87302012-87302034 TCATGAGGATGCAGGGAAATGGG + Intronic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1143768315 17:9151765-9151787 TCCTGGGTCTGCTGGGGAATTGG + Intronic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144744063 17:17601425-17601447 TGGTGAGTATGCAGGGAAATGGG - Intergenic
1146785334 17:35715480-35715502 TTTTGGGTTTCCTGGGAAATGGG + Intronic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1147339139 17:39743483-39743505 TCGTGAATCTGCAGTGAAATGGG - Intronic
1147683531 17:42271826-42271848 TATTGGGGCAGCAGGGGAATAGG + Intronic
1147961659 17:44171167-44171189 TCTGTGGTCTGCAGGGAAGGAGG - Intronic
1148894838 17:50833588-50833610 TCTTGGGACTGCCCAGAAATCGG + Intergenic
1149896582 17:60433086-60433108 TCTGGGGTCTGGAGGGCAGTGGG + Intergenic
1151068539 17:71180925-71180947 TCTTGGGTTTACAGGGACAGAGG - Intergenic
1152558061 17:81064409-81064431 TCAGGGCTCTGCAGGGAAAGGGG - Intronic
1153273605 18:3347385-3347407 TCTGGGAACTGTAGGGAAATGGG - Intergenic
1154306289 18:13233177-13233199 TCTTGGGTCTGCTTGGACACGGG + Intronic
1154384393 18:13880194-13880216 TCTTGGAACTGCAGGGCAGTCGG - Intergenic
1154977375 18:21473043-21473065 ACTTGGGTCTGGAGGAAAATGGG + Exonic
1155103771 18:22640541-22640563 GCTTGGGTGTGCAGTGAAAATGG - Intergenic
1156997282 18:43482958-43482980 TTATGGGTCTGTAGGGAAACAGG + Intergenic
1157437638 18:47684268-47684290 TCTTAGGCCTGCAAGGAACTTGG + Intergenic
1158563170 18:58532432-58532454 CCTTGAGTCAGCAGGTAAATGGG - Intronic
1158735708 18:60076016-60076038 TCTTGGGCCTCCAGGCAACTTGG - Intergenic
1165448125 19:35868057-35868079 TCCTGGGTCTGAAGGAGAATGGG + Intronic
1168294749 19:55373170-55373192 TCCTGGGTCTGAAGGGGAAGGGG - Intergenic
926304654 2:11629162-11629184 TCCAGGGTCTGCAGGGAAGGAGG - Intronic
927948991 2:27154897-27154919 TCCTGGGGATGAAGGGAAATTGG + Exonic
928981474 2:37139926-37139948 TCCTGGGTATTCAGAGAAATTGG - Intronic
931249059 2:60514317-60514339 TCTTGGGACTGCCCAGAAATGGG - Intronic
931836998 2:66109478-66109500 TCTTTGGACTGGAGGGAAAATGG + Intergenic
934478650 2:94613711-94613733 TGTTGAGGCTGCAGAGAAATAGG - Intergenic
935047916 2:99498480-99498502 TCTTAGGTATGGAGGGAAATGGG - Intergenic
936285565 2:111178736-111178758 TCAGGGGTCTGGAGGGAGATGGG - Intergenic
937339422 2:121081625-121081647 TCTGTGGTCTGCAGGGCAGTGGG + Intergenic
937503500 2:122509947-122509969 TTTAGGGTCTGAAGGGGAATAGG + Intergenic
938128836 2:128693739-128693761 TGCTGGGTCTGCTGGGAAATAGG - Intergenic
939639311 2:144619797-144619819 TGCTGGTGCTGCAGGGAAATAGG + Intergenic
942457672 2:176149202-176149224 TCTTTGGCATTCAGGGAAATTGG + Intergenic
942535477 2:176958501-176958523 TCTGGGGCATGAAGGGAAATGGG - Intergenic
945169072 2:206977157-206977179 CTTCAGGTCTGCAGGGAAATTGG - Intergenic
946354226 2:219174950-219174972 TCTTGGCTCTTTAGGGAGATGGG + Intronic
948244684 2:236470078-236470100 TCCTGAGTTTGCGGGGAAATAGG + Intronic
948746876 2:240103052-240103074 GCTAGGGTCTGCAGGGAAGGAGG + Intergenic
948777196 2:240295897-240295919 TCATCGGTCAGCAGGGAAATGGG - Intergenic
1168823554 20:793488-793510 TCTTAGGTACGGAGGGAAATAGG - Intergenic
1169414866 20:5407304-5407326 TGTGGGCTCTGCAGAGAAATGGG + Intergenic
1169674014 20:8133397-8133419 TCATGGGCCTGCAGGCAAGTGGG + Intronic
1170276824 20:14600868-14600890 TCTTTGCTCTGAAGGTAAATTGG + Intronic
1170615099 20:17942006-17942028 TCATGGGTTTGTAGGGACATGGG + Exonic
1172138236 20:32702570-32702592 TCCTGGGTCTCCAGTGAAATTGG - Intergenic
1173465474 20:43277663-43277685 TCTGGGATCTCCAGGGAATTTGG - Intergenic
1173575178 20:44108463-44108485 TCTGGGGTCTGAAGGGAGAGGGG + Intergenic
1174099553 20:48116808-48116830 AGTGGGGTCTGCATGGAAATAGG - Intergenic
1175423707 20:58851577-58851599 TCTGGGGTCTGCAGAGGGATTGG - Intronic
1179187172 21:39093963-39093985 TCTTGGGGTTGTAGGGAAAGGGG - Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1180438568 22:15339305-15339327 TGTTGGGTCCCCAGGGTAATGGG - Intergenic
1180521428 22:16209749-16209771 TGTTGGGTCCCCAGGGTAATGGG - Intergenic
1183932985 22:41246665-41246687 TGTTGGGCCTGCGGGGAAAGAGG + Exonic
1185371542 22:50463135-50463157 TCCTCGGTCTGCAGGGAACAGGG - Intronic
951788542 3:26452615-26452637 TCATGGGTCTGGAGGGAAGAGGG + Intergenic
954770013 3:52958634-52958656 TGTTGAGGCTGCAGAGAAATAGG + Intronic
957159570 3:76592293-76592315 TCTTGAGCCTCCAGGGGAATTGG - Intronic
958443041 3:94179626-94179648 TCTTATATCTGCAGGGAAGTCGG + Intergenic
959888925 3:111532522-111532544 TCCTATGACTGCAGGGAAATGGG - Intronic
962048778 3:131790377-131790399 TCTTTGTTCTGCAGGCCAATTGG + Intronic
965579345 3:170250493-170250515 TCTGGGGCCTGCAGAGAAAGGGG - Intronic
967286077 3:187871903-187871925 TCTCAGGTCTTCATGGAAATGGG - Intergenic
967888886 3:194351193-194351215 TCCAGGGTCTGCAGGGACGTGGG - Intronic
968212953 3:196864615-196864637 TGTTGAGGCTGCAGAGAAATGGG + Intergenic
968835973 4:2964221-2964243 TCGGGGCTCTCCAGGGAAATCGG - Intronic
969615379 4:8249258-8249280 TCAGGGCTCTCCAGGGAAATGGG + Intergenic
970785576 4:19792536-19792558 TGTTAGGTCTGCGGAGAAATGGG + Intergenic
976636007 4:87287037-87287059 TCTGGGGTCTGGAGGACAATGGG - Intergenic
976670402 4:87646058-87646080 TCTGGGGCCTGTTGGGAAATTGG - Intergenic
977301557 4:95273550-95273572 TCTTGCTTCTTCAGGGAGATGGG + Intronic
977565684 4:98578236-98578258 TGTTGGCTCTGCAGGGATAAAGG - Intronic
977751365 4:100613641-100613663 GCTGGGGTCTGCAGTGAAGTTGG + Intronic
978313882 4:107414875-107414897 TCTTAGGTATGGAGGGAAATGGG - Intergenic
982164752 4:152604429-152604451 TCTGTGGCCTGCAGGGAACTGGG + Intergenic
984623575 4:181980057-181980079 TCTGGGGCCTGCAGGCAAAGTGG - Intergenic
989125536 5:38049097-38049119 CCTTGGGTATGCAGGGGAGTGGG + Intergenic
990438459 5:55819619-55819641 TTTTGTGTCTGCAGGGAGAATGG + Intergenic
992784085 5:80153835-80153857 TAGTGGTTCTGCAGGGAAACAGG - Intronic
994731600 5:103498385-103498407 TTTTAGGTCTGCAGGGAGGTAGG + Intergenic
995890398 5:116944627-116944649 TATTATGTCTCCAGGGAAATAGG - Intergenic
997575836 5:134976576-134976598 TCTTGGGTCTGGAGAGCAGTGGG + Intronic
997714381 5:136030931-136030953 TCTGGGCTCTGAAGGGAAAGAGG - Intronic
997725716 5:136118359-136118381 TCCTGGTTCTGCTGGGAGATTGG - Intergenic
998404367 5:141865621-141865643 TCTGGGCTCTTCAGGAAAATAGG - Intronic
1000026116 5:157360585-157360607 TCATGGGACTGCTGGGAAGTTGG + Intronic
1000358506 5:160424503-160424525 TCTTAGGTCAGGAGGGGAATAGG + Intronic
1001439585 5:171731374-171731396 TCTTGTGTGTGGTGGGAAATAGG - Intergenic
1003965361 6:11247595-11247617 TCTGGGGCCTGGGGGGAAATGGG - Intronic
1004131573 6:12925822-12925844 GCTTTGGGTTGCAGGGAAATGGG - Intronic
1004368090 6:15028990-15029012 TCGAGGGTCTGAAGGGCAATGGG - Intergenic
1004632414 6:17434633-17434655 TCAGGGGTATGGAGGGAAATGGG - Intronic
1005087650 6:22023282-22023304 TCTTGGGTCCATAAGGAAATTGG - Intergenic
1005151742 6:22759567-22759589 TCTTTGGGCTGCAGTGAAAGGGG - Intergenic
1006558606 6:34889656-34889678 TCTTGGGTCCCCAGAGAGATCGG + Intronic
1006866859 6:37215748-37215770 GCTTGGGTCTTCAGAGACATGGG + Intronic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1007992654 6:46273211-46273233 TTTTTGGCCAGCAGGGAAATTGG + Intronic
1008070288 6:47092567-47092589 TCTTGGCTCTACAAGCAAATGGG + Intergenic
1011430153 6:87277166-87277188 AGTTGGGTCTGGAGTGAAATTGG + Intergenic
1013296173 6:108760240-108760262 TCTTGGGCCTGGAGGGTAAAGGG + Intergenic
1014124554 6:117761196-117761218 TCTTGGCTCTGCAGCAAAGTTGG - Intergenic
1017961023 6:159220758-159220780 TCTTGAGTCTGCACGGATTTGGG - Intronic
1017992298 6:159502012-159502034 TGATGGGTCTGCAGAGAAGTGGG - Intergenic
1020354545 7:7262267-7262289 TCTTTGGTTTTCATGGAAATTGG - Intergenic
1026685982 7:72510577-72510599 TCTTGGGGCAGACGGGAAATGGG - Intergenic
1029714761 7:102319881-102319903 TTTTGGCTCTGCAGGGACAGAGG + Intronic
1032326632 7:130935146-130935168 TCTTGAGTCTGAAGGGAGACTGG + Intergenic
1032490081 7:132318014-132318036 ACTCGGGTCTTCAGGGAAAATGG - Intronic
1033234003 7:139623911-139623933 TCCTACGTCTGCAGGGAAAAGGG - Intronic
1035245790 7:157561302-157561324 CCTGGAGTCTGCAGGGAAGTGGG - Intronic
1039911822 8:41832533-41832555 TCTTGGGTCTTCAGGGCTTTGGG - Intronic
1042714415 8:71756772-71756794 TCTGTGGTCTGCAGACAAATTGG + Intergenic
1045652617 8:104355225-104355247 TGTTGAGTTTGGAGGGAAATGGG + Intronic
1047116000 8:121842504-121842526 TCTGGGGTCTGGAGGACAATGGG - Intergenic
1049514097 8:143044427-143044449 TTGTGGGTCTGCAGGGACAGGGG - Intronic
1050522769 9:6518759-6518781 TCTTGGGTACGGAGGGGAATGGG - Intergenic
1052026228 9:23576520-23576542 TCTAGGGGCTGCAGGGAGACAGG - Intergenic
1052303055 9:26974939-26974961 CCTTAGGTGTGGAGGGAAATGGG + Intronic
1052820398 9:33133922-33133944 TCTAAAGTCTGCAGGGAGATGGG - Intronic
1053679408 9:40472376-40472398 TGTTGAGGCTGCAGAGAAATAGG + Intergenic
1053701574 9:40698175-40698197 TGTTGGGTCCCCAGGGTAATGGG + Intergenic
1053929402 9:43100721-43100743 TGTTGAGGCTGCAGAGAAATAGG + Intergenic
1054284309 9:63152567-63152589 TGTTGAGGCTGCAGAGAAATAGG - Intergenic
1054292490 9:63307914-63307936 TGTTGAGGCTGCAGAGAAATAGG + Intergenic
1054390509 9:64612388-64612410 TGTTGAGGCTGCAGAGAAATAGG + Intergenic
1054411639 9:64821630-64821652 TGTTGGGTCCCCAGGGTAATGGG + Intergenic
1054505209 9:65903919-65903941 TGTTGAGGCTGCAGAGAAATAGG - Intergenic
1056462078 9:86818171-86818193 TTTTGAGCCTGCAGGGAAAGGGG - Intergenic
1056600373 9:88042401-88042423 TCTTAGGTGTGGAGAGAAATGGG + Intergenic
1060061870 9:120467896-120467918 GCATGGGTTTCCAGGGAAATGGG - Exonic
1061547183 9:131311255-131311277 CCTTGGGTCTTCATGGAAAGGGG - Intergenic
1188888334 X:35578506-35578528 TGTTGGGCCTGCAGAGAAAAGGG + Intergenic
1189172640 X:38924605-38924627 TCTTGGGCCTGCAGGGATAAGGG + Intergenic
1189406321 X:40728319-40728341 TCTGGGGTATGAAGGGAAACTGG - Intronic
1189834311 X:45005071-45005093 TCTTAGGTATGGAGGGAAATGGG + Intronic
1194553031 X:95324579-95324601 TCTATGGTCATCAGGGAAATTGG - Intergenic
1197254318 X:124246660-124246682 TGTTGGGGATGTAGGGAAATGGG - Intronic
1197648886 X:129043734-129043756 TCTTGGGTTTGCAAGAAAAGAGG - Intergenic
1198486367 X:137091616-137091638 TATTGGCTCTGAAGGGAAAAGGG - Intergenic
1200937948 Y:8754753-8754775 TCATGAATCTGCAGTGAAATTGG - Intergenic