ID: 1142474700

View in Genome Browser
Species Human (GRCh38)
Location 17:181813-181835
Sequence GCCGCGAGTGTGCGCGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 137}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142474700_1142474712 20 Left 1142474700 17:181813-181835 CCCCGCGCGCGCACACTCGCGGC 0: 1
1: 0
2: 3
3: 16
4: 137
Right 1142474712 17:181856-181878 CTTCCGCTCATGCACGCCCGCGG No data
1142474700_1142474707 -6 Left 1142474700 17:181813-181835 CCCCGCGCGCGCACACTCGCGGC 0: 1
1: 0
2: 3
3: 16
4: 137
Right 1142474707 17:181830-181852 CGCGGCCAGGCAGGGCCGCCGGG 0: 1
1: 0
2: 1
3: 35
4: 414
1142474700_1142474706 -7 Left 1142474700 17:181813-181835 CCCCGCGCGCGCACACTCGCGGC 0: 1
1: 0
2: 3
3: 16
4: 137
Right 1142474706 17:181829-181851 TCGCGGCCAGGCAGGGCCGCCGG 0: 1
1: 0
2: 0
3: 15
4: 233
1142474700_1142474714 30 Left 1142474700 17:181813-181835 CCCCGCGCGCGCACACTCGCGGC 0: 1
1: 0
2: 3
3: 16
4: 137
Right 1142474714 17:181866-181888 TGCACGCCCGCGGCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142474700 Original CRISPR GCCGCGAGTGTGCGCGCGCG GGG (reversed) Intergenic