ID: 1142474848

View in Genome Browser
Species Human (GRCh38)
Location 17:182583-182605
Sequence TGGGAGGCCTAGAGTAGGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142474848_1142474855 9 Left 1142474848 17:182583-182605 CCACTCCTACTCTAGGCCTCCCA No data
Right 1142474855 17:182615-182637 ATCACTAAACAAATCCCAGAGGG No data
1142474848_1142474854 8 Left 1142474848 17:182583-182605 CCACTCCTACTCTAGGCCTCCCA No data
Right 1142474854 17:182614-182636 GATCACTAAACAAATCCCAGAGG No data
1142474848_1142474859 28 Left 1142474848 17:182583-182605 CCACTCCTACTCTAGGCCTCCCA No data
Right 1142474859 17:182634-182656 AGGGCCCAGCCCTGGCTGTCCGG No data
1142474848_1142474856 20 Left 1142474848 17:182583-182605 CCACTCCTACTCTAGGCCTCCCA No data
Right 1142474856 17:182626-182648 AATCCCAGAGGGCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142474848 Original CRISPR TGGGAGGCCTAGAGTAGGAG TGG (reversed) Intergenic
No off target data available for this crispr