ID: 1142476879

View in Genome Browser
Species Human (GRCh38)
Location 17:193985-194007
Sequence CTAGAACCCCAGAGGGAGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142476879_1142476889 15 Left 1142476879 17:193985-194007 CCCGGCTCCCTCTGGGGTTCTAG No data
Right 1142476889 17:194023-194045 CCACCCCTGTGTGGCCAGCGGGG No data
1142476879_1142476885 6 Left 1142476879 17:193985-194007 CCCGGCTCCCTCTGGGGTTCTAG No data
Right 1142476885 17:194014-194036 GCTCAAAGTCCACCCCTGTGTGG No data
1142476879_1142476887 14 Left 1142476879 17:193985-194007 CCCGGCTCCCTCTGGGGTTCTAG No data
Right 1142476887 17:194022-194044 TCCACCCCTGTGTGGCCAGCGGG No data
1142476879_1142476886 13 Left 1142476879 17:193985-194007 CCCGGCTCCCTCTGGGGTTCTAG No data
Right 1142476886 17:194021-194043 GTCCACCCCTGTGTGGCCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142476879 Original CRISPR CTAGAACCCCAGAGGGAGCC GGG (reversed) Intergenic
No off target data available for this crispr