ID: 1142477396

View in Genome Browser
Species Human (GRCh38)
Location 17:197335-197357
Sequence CACACTCAACTGACTAGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142477396_1142477397 -1 Left 1142477396 17:197335-197357 CCAACTCTAGTCAGTTGAGTGTG No data
Right 1142477397 17:197357-197379 GTGCACAGTTGTGTGTGTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142477396 Original CRISPR CACACTCAACTGACTAGAGT TGG (reversed) Intergenic
No off target data available for this crispr