ID: 1142478033

View in Genome Browser
Species Human (GRCh38)
Location 17:201236-201258
Sequence CCCAGGACACAGACATGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478033_1142478042 21 Left 1142478033 17:201236-201258 CCAGGTCATGTCTGTGTCCTGGG No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data
1142478033_1142478038 0 Left 1142478033 17:201236-201258 CCAGGTCATGTCTGTGTCCTGGG No data
Right 1142478038 17:201259-201281 GAAGGCCGAAGCCCTTGCTAAGG No data
1142478033_1142478043 29 Left 1142478033 17:201236-201258 CCAGGTCATGTCTGTGTCCTGGG No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478033 Original CRISPR CCCAGGACACAGACATGACC TGG (reversed) Intergenic