ID: 1142478037

View in Genome Browser
Species Human (GRCh38)
Location 17:201253-201275
Sequence CAAGGGCTTCGGCCTTCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478037_1142478045 22 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478037_1142478042 4 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data
1142478037_1142478043 12 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478037 Original CRISPR CAAGGGCTTCGGCCTTCCCC AGG (reversed) Intergenic
No off target data available for this crispr