ID: 1142478039

View in Genome Browser
Species Human (GRCh38)
Location 17:201264-201286
Sequence AGAAACCTTAGCAAGGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478039_1142478045 11 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478039_1142478043 1 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478039_1142478047 25 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478047 17:201312-201334 CTGCTTTGGCTGAGTTAATTCGG No data
1142478039_1142478042 -7 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478039 Original CRISPR AGAAACCTTAGCAAGGGCTT CGG (reversed) Intergenic