ID: 1142478040

View in Genome Browser
Species Human (GRCh38)
Location 17:201270-201292
Sequence TATTACAGAAACCTTAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478040_1142478045 5 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478040_1142478043 -5 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478040_1142478047 19 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478047 17:201312-201334 CTGCTTTGGCTGAGTTAATTCGG No data
1142478040_1142478048 27 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478048 17:201320-201342 GCTGAGTTAATTCGGTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478040 Original CRISPR TATTACAGAAACCTTAGCAA GGG (reversed) Intergenic