ID: 1142478041

View in Genome Browser
Species Human (GRCh38)
Location 17:201271-201293
Sequence ATATTACAGAAACCTTAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478041_1142478043 -6 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478041_1142478045 4 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478041_1142478048 26 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478048 17:201320-201342 GCTGAGTTAATTCGGTGTTGAGG No data
1142478041_1142478049 30 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478049 17:201324-201346 AGTTAATTCGGTGTTGAGGTCGG No data
1142478041_1142478047 18 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478047 17:201312-201334 CTGCTTTGGCTGAGTTAATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478041 Original CRISPR ATATTACAGAAACCTTAGCA AGG (reversed) Intergenic