ID: 1142478042

View in Genome Browser
Species Human (GRCh38)
Location 17:201280-201302
Sequence GGTTTCTGTAATATCACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478033_1142478042 21 Left 1142478033 17:201236-201258 CCAGGTCATGTCTGTGTCCTGGG No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data
1142478037_1142478042 4 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data
1142478039_1142478042 -7 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478042 17:201280-201302 GGTTTCTGTAATATCACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478042 Original CRISPR GGTTTCTGTAATATCACCTG TGG Intergenic