ID: 1142478043

View in Genome Browser
Species Human (GRCh38)
Location 17:201288-201310
Sequence TAATATCACCTGTGGCTCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478041_1142478043 -6 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478039_1142478043 1 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478037_1142478043 12 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478040_1142478043 -5 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data
1142478033_1142478043 29 Left 1142478033 17:201236-201258 CCAGGTCATGTCTGTGTCCTGGG No data
Right 1142478043 17:201288-201310 TAATATCACCTGTGGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478043 Original CRISPR TAATATCACCTGTGGCTCTG AGG Intergenic