ID: 1142478045

View in Genome Browser
Species Human (GRCh38)
Location 17:201298-201320
Sequence TGTGGCTCTGAGGCCTGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1142478039_1142478045 11 Left 1142478039 17:201264-201286 CCGAAGCCCTTGCTAAGGTTTCT No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478040_1142478045 5 Left 1142478040 17:201270-201292 CCCTTGCTAAGGTTTCTGTAATA No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478041_1142478045 4 Left 1142478041 17:201271-201293 CCTTGCTAAGGTTTCTGTAATAT No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data
1142478037_1142478045 22 Left 1142478037 17:201253-201275 CCTGGGGAAGGCCGAAGCCCTTG No data
Right 1142478045 17:201298-201320 TGTGGCTCTGAGGCCTGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1142478045 Original CRISPR TGTGGCTCTGAGGCCTGCTT TGG Intergenic